prev. next SHA1: XwAlPcZOsXkUGBV7t4i4h/BbNRY 16128741 2506624 7429184 1786990	orf, hypothetical protein [Escherichia coli K12]	393	0	89	139	155	YM8Iewtw/BEuqk6/hDHtSxJE8HI 13195606 12805671 346 E: .17E0 Ident: 19/110 Ident% 17 Q: 30-133 (393)   S: 166-250 (346) RIKEN cDNA 4733401F03 [Mus musculus] Pos: 38/110 Gap: 31/110 4cv5NXxwCfHhRMUkUUJvTDYEDuY 17457499 15342081 346 E: .73E0 Ident: 22/109 Ident% 20 Q: 32-134 (393)   S: 168-251 (346) Similar to RIKEN cDNA 4733401F03 gene [Homo sapiens] Pos: 38/109 Gap: 31/109 ReFVZ0dvl+fOZ6kdB1Y9ZmdAuB8 6841174 174 E: .77E0 Ident: 19/83 Ident% 22 Q: 53-134 (393)   S: 22-79 (174) HSPC262 [Homo sapiens] Pos: 29/83 Gap: 26/83 dFEpkvP4QxKw0ZHxAz3eBjVm3Tg 17551860 7494913 3873737 803 E: 6.8E0 Ident: 12/63 Ident% 19 Q: 104-158 (393)   S: 572-634 (803) Amino terminus of this predicted protein is proline rich and contains 3 tandem repeats of the sequence PEPV~cDNA EST yk260e8.3 comes from this gene~cDNA EST yk260e8.5 comes from this gene~cDNA EST yk270c11.3 comes from this gene~cDNA EST yk270 Pos: 23/63 Gap: 8/63 dcLfembXnFfHZBqaFHbNogFg0Xs 14495296 393 E: 9.4E0 Ident: 19/98 Ident% 19 Q: 12-103 (393)   S: 170-264 (393) hypothetical transcriptional regulator [Arthrobacter nicotinovorans] hypothetical transcriptional regulator [Arthrobacter nicotinovorans] Pos: 30/98 Gap: 9/98 0IojZAyp983372gy19jWwcnhJfI 17560746 6093649 7503027 2291199 221 E: 4E-12 Ident: 25/96 Ident% 26 Q: 32-121 (393)   S: 86-159 (221) Similar to phosphatidylethanolamine binding protein; coded for by C. elegans cDNA yk106a12.5; coded for by C. elegans cDNA yk106a12.3 [Caenorhabditis elegans] Pos: 36/96 Gap: 28/96 OYMGltcx8bjGddEv5z5Hh9y5OjE 6323207 400619 101655 577211 228464 219 E: 2E-13 Ident: 24/89 Ident% 26 Q: 39-121 (393)   S: 82-168 (219) Tfs1p: CDC25-dependent, ammonia-responsive cell-cycle regulator [Saccharomyces cerevisiae] Pos: 36/89 Gap: 8/89 6NY/YmyO5c8tNYfXtujwvP2chIc 4505621 1352726 2135907 2135908 3659987 3659996 3659997 3659986 406290 435638 704465 14250526 16924245 1582028 187 E: 3E-14 Ident: 29/103 Ident% 28 Q: 28-124 (393)   S: 47-128 (187) Phosphatidylethanolamine-binding protein (PEBP) (Neuropolypeptide h3) (Hippocampal cholinergic neurostimulating peptide) (HCNP) (Raf kinase inhibitor protein) (RKIP) Pos: 45/103 Gap: 27/103
prev. next SHA1: 3tDWJBUQ+6tCW8kAhgxsuC+vapc 16128601 7447948 1778535 1786835	citrate lyase synthetase (citrate (pro-3S)-lyase ligase [Escherichia coli K12]	157	0	31	158	396	wab70/08cWlnz94Ati8EBdN7I3c 15965185 15074365 156 E: 2.4E0 Ident: 22/100 Ident% 22 Q: 68-154 (157)   S: 51-150 (156) PUTATIVE ACETYLTRANSFERASE PROTEIN [Sinorhizobium meliloti] PUTATIVE ACETYLTRANSFERASE PROTEIN [Sinorhizobium meliloti] Pos: 39/100 Gap: 13/100 G5aZQtq6KMWvAqOUxanL7SLNvVc 4505651 12585314 1817548 12653167 389 E: 6.9E0 Ident: 20/112 Ident% 17 Q: 98-206 (157)   S: 140-245 (389) phosphate cytidylyltransferase 2, ethanolamine [Homo sapiens] Ethanolamine-phosphate cytidylyltransferase (Phosphorylethanolamine transferase) (CTP:phosphoethanolamine cytidylyltransferase) phosphoethanolamine cytidylyltransferase [Homo sapiens] phosphate cytidylyltransferase 2, ethanolamine [Homo sapiens] phosphate cytidylyltransferase 2, ethanolamine [Homo sapiens] Ethanolamine-phosphate cytidylyltransferase (Phosphorylethanolamine transferase) (CTP:phosphoethanolamine cytidylyltransferase) phosphoethanolamine cytidylyltransferase [Homo sapiens] phosphate cytidylyltransferase 2, ethanolamine [Homo sapiens] Pos: 42/112 Gap: 9/112 BKZb5RM2bR8tUdr0nFyX2nEYIko 15839592 13879707 323 E: 3.9E0 Ident: 11/63 Ident% 17 Q: 177-234 (157)   S: 4-66 (323) transcriptional regulator, putative [Mycobacterium tuberculosis CDC1551] transcriptional regulator, putative [Mycobacterium tuberculosis CDC1551] transcriptional regulator, putative [Mycobacterium tuberculosis CDC1551] transcriptional regulator, putative [Mycobacterium tuberculosis CDC1551] Pos: 21/63 Gap: 5/63 3VVcKAtSSP/BsAQBgqWq82ScI3k 15965315 15074495 169 E: 1.3E0 Ident: 18/89 Ident% 20 Q: 74-149 (157)   S: 60-147 (169) PUTATIVE ACETYLTRANSFERASE (ANTIBIOTIC RESISTANCE ) PROTEIN [Sinorhizobium meliloti] PUTATIVE ACETYLTRANSFERASE (ANTIBIOTIC RESISTANCE ) PROTEIN [Sinorhizobium meliloti] Pos: 28/89 Gap: 14/89 k+yn5yoZUndid0DUNmdzL8vQ8qI 15617055 11182414 10039120 442 E: .81E0 Ident: 19/95 Ident% 20 Q: 51-139 (157)   S: 319-412 (442) amino-acid acetyltransferase [Buchnera sp. APS] Amino-acid acetyltransferase (N-acetylglutamate synthase) (AGS) (NAGS) Amino-acid acetyltransferase (N-acetylglutamate synthase) (AGS) (NAGS) amino-acid acetyltransferase [Buchnera sp. APS] Pos: 36/95 Gap: 7/95 IqYsVj/L6X+X8A2+KfrLI7x2k4I 15965915 15075184 291 E: .36E0 Ident: 11/54 Ident% 20 Q: 159-212 (157)   S: 7-59 (291) PROBABLE PANTOATE--BETA-ALANINE LIGASE PROTEIN [Sinorhizobium meliloti] PROBABLE PANTOATE--BETA-ALANINE LIGASE PROTEIN [Sinorhizobium meliloti] Pos: 22/54 Gap: 1/54 RTu06LXREc6RVIpkoWR6JFkym8M 15799817 15829391 12512848 13359593 283 E: 1.9E0 Ident: 8/50 Ident% 16 Q: 163-212 (157)   S: 11-59 (283) pantothenate synthetase [Escherichia coli O157:H7 EDL933] pantothenate synthetase [Escherichia coli O157:H7] pantothenate synthetase [Escherichia coli O157:H7 EDL933] pantothenate synthetase [Escherichia coli O157:H7] Pos: 22/50 Gap: 1/50 q3WPyyRwsMXCUdnHT2zD3ggrIZs 16803129 16410491 127 E: .32E0 Ident: 13/68 Ident% 19 Q: 175-235 (157)   S: 2-68 (127) highly similar to glycerol-3-phosphate cytidylyltransferase (gct), CDP-glycerol pyrophosphorylase (teichoic acid biosynthesis protein D) [Listeria monocytogenes EGD-e] highly similar to glycerol-3-phosphate cytidylyltransferase (gct), CDP-glycerol pyrophosphorylase (teichoic acid biosynthesis protein D) [Listeria monocytogenes EGD-e] highly similar to glycerol-3-phosphate cytidylyltransferase (gct), CDP-glycerol pyrophosphorylase (teichoic acid biosynthesis protein D) [Listeria monocytogenes] highly similar to glycerol-3-phosphate cytidylyltransferase (gct), CDP-glycerol pyrophosphorylase (teichoic acid biosynthesis protein D) [Listeria monocytogenes] Pos: 29/68 Gap: 8/68 iXRwBGSzvFC66TJNdTZBOtKeeqk 16123208 15980984 141 E: .003E0 Ident: 15/71 Ident% 21 Q: 66-132 (157)   S: 43-113 (141) putative acetyltransferase [Yersinia pestis] putative acetyltransferase [Yersinia pestis] Pos: 27/71 Gap: 4/71 eERoWjTKHqnSQnHWyRaDPuGjV24 18310664 18145345 309 E: 2.2E0 Ident: 31/179 Ident% 17 Q: 181-354 (157)   S: 21-182 (309) riboflavin biosynthesis protein [Clostridium perfringens] riboflavin biosynthesis protein [Clostridium perfringens] Pos: 59/179 Gap: 22/179 NIqzlr7Xc4jpLeWg9lRfpYtG5vU 15887596 17934162 15155137 17738575 172 E: .1E0 Ident: 19/95 Ident% 20 Q: 69-151 (157)   S: 63-156 (172) acetyltransferase [Agrobacterium tumefaciens str. C58 (U. Washington)] acetyltransferase [Agrobacterium tumefaciens str. C58 (U. Washington)] Pos: 39/95 Gap: 13/95 ALGOjNFgQDDemkHMIuTNdkmL59k 16329865 10720119 7470176 1652350 200 E: .4E0 Ident: 12/66 Ident% 18 Q: 175-231 (157)   S: 2-67 (200) Probable nicotinate-nucleotide adenylyltransferase (Deamido-NAD(+) pyrophosphorylase) (Deamido-NAD(+) diphosphorylase) (Nicotinate mononucleotide adenylyltransferase) (NAMN adenylyltransferase) Pos: 22/66 Gap: 9/66 NR4kd/1sbOakC4RB3xsIS2GTHUc 15792914 11347155 6969026 386 E: .58E0 Ident: 30/151 Ident% 19 Q: 144-289 (157)   S: 124-249 (386) possible sulfate adenylyltransferase [Campylobacter jejuni] probable sulfate adenylyltransferase (EC 2.7.7.4) Cj1609 [imported] - Campylobacter jejuni (strain NCTC 11168) possible sulfate adenylyltransferase [Campylobacter jejuni] Pos: 54/151 Gap: 30/151 tbBZB+l61fmE/SAGX83pBAAIRXk 15677849 10720111 11278845 7227286 201 E: .097E0 Ident: 18/67 Ident% 26 Q: 174-230 (157)   S: 2-64 (201) Probable nicotinate-nucleotide adenylyltransferase (Deamido-NAD(+) pyrophosphorylase) (Deamido-NAD(+) diphosphorylase) (Nicotinate mononucleotide adenylyltransferase) (NAMN adenylyltransferase) Pos: 27/67 Gap: 14/67 zRuXYxO4jdZkloWXnEz4Yqgo/hw 15607078 8134617 7449522 2984326 282 E: 1.2E0 Ident: 15/56 Ident% 26 Q: 157-212 (157)   S: 6-60 (282) pantothenate synthetase [Aquifex aeolicus] Pantoate--beta-alanine ligase (Pantothenate synthetase) (Pantoate activating enzyme) Pantoate--beta-alanine ligase (Pantothenate synthetase) (Pantoate activating enzyme) pantothenate synthetase - Aquifex aeolicus pantothenate synthetase [Aquifex aeolicus] Pos: 23/56 Gap: 1/56 /A/7JYtxZnONI0gR83q59E+rmH0 10720107 193 E: 9.7E0 Ident: 10/64 Ident% 15 Q: 175-230 (157)   S: 2-64 (193) Probable nicotinate-nucleotide adenylyltransferase (Deamido-NAD(+) pyrophosphorylase) (Deamido-NAD(+) diphosphorylase) (Nicotinate mononucleotide adenylyltransferase) (NAMN adenylyltransferase) Pos: 21/64 Gap: 9/64 4Zi7LCKoBJhZqIL/CLYXVNFzYCE 15242389 11257268 9755622 149 E: .22E0 Ident: 15/96 Ident% 15 Q: 57-138 (157)   S: 42-136 (149) acetyltransferase-like protein [Arabidopsis thaliana] acetyltransferase-like protein - Arabidopsis thaliana acetyltransferase-like protein [Arabidopsis thaliana] Pos: 32/96 Gap: 15/96 Q8pGQ5FErCM1qSy98sUreeno6Qo 16554495 162 E: 1.5E0 Ident: 9/34 Ident% 26 Q: 181-212 (157)   S: 7-37 (162) Predicted nucleotidyltransferase [Halobacterium sp. NRC-1] Pos: 16/34 Gap: 5/34 y5O8CAXoxdMAty8UVpiBwqaIaIE 1075280 155 E: 1.3E0 Ident: 14/83 Ident% 16 Q: 73-149 (157)   S: 56-138 (155) peptide N-acetyltransferase (EC 2.3.1.-) rimI - Haemophilus influenzae (strain Rd KW20) Pos: 31/83 Gap: 6/83 dZcTMzhLPsz4yloV0y+D39MdNVA 15895822 15025584 151 E: 4.9E0 Ident: 21/125 Ident% 16 Q: 34-149 (157)   S: 14-138 (151) Predicted acetyltransferase [Clostridium acetobutylicum] Predicted acetyltransferase [Clostridium acetobutylicum] Pos: 48/125 Gap: 9/125 wx39JWJjpVC2e5uepeP4mFBuyHw 16764934 16420114 171 E: .038E0 Ident: 15/68 Ident% 22 Q: 87-150 (157)   S: 81-147 (171) putative acyltransferase [Salmonella typhimurium LT2] putative acyltransferase [Salmonella typhimurium LT2] Pos: 26/68 Gap: 5/68 jZhlTZ0V7OdJUtEMemWvdlALJAo 18309465 18144142 140 E: .007E0 Ident: 14/60 Ident% 23 Q: 175-226 (157)   S: 5-64 (140) probable glycerol-3-phosphate cytidyltransferase [Clostridium perfringens] probable glycerol-3-phosphate cytidyltransferase [Clostridium perfringens] Pos: 27/60 Gap: 8/60 I1qSu66/yhC3M45NaxS/mZ/emL8 11499013 7451667 2649161 137 E: 6.8E0 Ident: 6/33 Ident% 18 Q: 181-213 (157)   S: 4-36 (137) glycerol-3-phosphate cytidyltransferase (taqD) [Archaeoglobus fulgidus] glycerol-3-phosphate cytidyltransferase (taqD) homolog - Archaeoglobus fulgidus glycerol-3-phosphate cytidyltransferase (taqD) [Archaeoglobus fulgidus] Pos: 14/33 Gap: -1/-1 yggBRquFtjlc48is3y9aKXj7Vh0 1361224 42742 537213 161 E: .021E0 Ident: 13/65 Ident% 20 Q: 88-149 (157)   S: 66-130 (161) peptide N-acetyltransferase (EC 2.3.1.-) rimI - Escherichia coli Pos: 25/65 Gap: 3/65 IVwY8cgLNTv+6yUDVVTMdfR/JLQ 15678178 7450068 13787044 2621191 181 E: .4E0 Ident: 12/59 Ident% 20 Q: 177-230 (157)   S: 6-64 (181) Chain A, Crystal Structure Of Methanobacterium Thermoautotrophicum Nicotinamide Mononucleotide Adenylyltransferase With Bound Nad Pos: 23/59 Gap: 5/59 BBTpLAZeu1P7o27HtGWz+j3GFJM 17229482 17131080 213 E: .92E0 Ident: 22/126 Ident% 17 Q: 63-176 (157)   S: 54-164 (213) N-terminal acetyltransferase [Nostoc sp. PCC 7120] N-terminal acetyltransferase [Nostoc sp. PCC 7120] Pos: 44/126 Gap: 27/126 EeEDdAgKWTd7XVPWNv8aSo50+h8 16762884 16505191 145 E: 6.2E0 Ident: 15/72 Ident% 20 Q: 69-140 (157)   S: 54-123 (145) putative acetyltransferase [Salmonella enterica subsp. enterica serovar Typhi] putative acetyltransferase [Salmonella enterica subsp. enterica serovar Typhi] Pos: 29/72 Gap: 2/72 EPEQZ4pfUFN905k5DrSN7BHSFlQ 15643835 8134623 7449525 4981622 280 E: 4.5E0 Ident: 12/54 Ident% 22 Q: 167-220 (157)   S: 15-67 (280) pantoate--beta-alanine ligase [Thermotoga maritima] Pantoate--beta-alanine ligase (Pantothenate synthetase) (Pantoate activating enzyme) Pantoate--beta-alanine ligase (Pantothenate synthetase) (Pantoate activating enzyme) pantoate--beta-alanine ligase - Thermotoga maritima (strain MSB8) pantoate--beta-alanine ligase [Thermotoga maritima] Pos: 23/54 Gap: 1/54 C+dhvdflUXX6Z9uXc2Q80UnNs3g 1742360 1742364 212 E: .42E0 Ident: 14/67 Ident% 20 Q: 87-149 (157)   S: 121-186 (212) Phosphinothricin acetyltransferase (EC 2.3.1.-). [Escherichia coli] Phosphinothricin acetyltransferase (EC 2.3.1.-). [Escherichia coli] Pos: 25/67 Gap: 5/67 SyDk+871mmOrFYm8edTMpgqy1Zs 3248948 153 E: 4.7E0 Ident: 10/34 Ident% 29 Q: 321-354 (157)   S: 40-73 (153) riboflavin kinase [Coxiella burnetii] Pos: 19/34 Gap: -1/-1 PrSBThojCANPkw+QMa5WeeAOM6c 13358032 10720121 11356817 6899463 392 E: 5.7E0 Ident: 14/80 Ident% 17 Q: 175-237 (157)   S: 2-81 (392) Probable nicotinate-nucleotide adenylyltransferase (Deamido-NAD(+) pyrophosphorylase) (Deamido-NAD(+) diphosphorylase) (Nicotinate mononucleotide adenylyltransferase) (NAMN adenylyltransferase) Pos: 25/80 Gap: 17/80 pmWXPwAkytfXszXpWtm3TyV4yrA 10720115 188 E: .06E0 Ident: 42/193 Ident% 21 Q: 181-364 (157)   S: 3-181 (188) Probable nicotinate-nucleotide adenylyltransferase (Deamido-NAD(+) pyrophosphorylase) (Deamido-NAD(+) diphosphorylase) (Nicotinate mononucleotide adenylyltransferase) (NAMN adenylyltransferase) Pos: 67/193 Gap: 23/193 I2I2ywsV8Qw3LzduJSYDBqdTwY4 15888645 17935220 15156373 17739729 165 E: .44E0 Ident: 13/81 Ident% 16 Q: 67-142 (157)   S: 60-140 (165) acetyltransferase [Agrobacterium tumefaciens str. C58 (U. Washington)] acetyltransferase [Agrobacterium tumefaciens str. C58 (U. Washington)] Pos: 28/81 Gap: 5/81 zQwoUeLYQU38u5Fb8MScqO6eKtc 18313208 18160724 166 E: 2.3E0 Ident: 15/72 Ident% 20 Q: 81-139 (157)   S: 50-121 (166) N-acetyltransferase [Pyrobaculum aerophilum] N-acetyltransferase [Pyrobaculum aerophilum] Pos: 27/72 Gap: 13/72 LJ5XLSfIC+1OwBzaaoLyFwxJAho 15804474 12518774 329 E: .014E0 Ident: 17/83 Ident% 20 Q: 62-139 (157)   S: 56-138 (329) putative acetyltransferase (EC 2.3.1.18) [Escherichia coli O157:H7 EDL933] putative acetyltransferase (EC 2.3.1.18) [Escherichia coli O157:H7 EDL933] Pos: 33/83 Gap: 5/83 trfKxf8vX4Uh3nN4w2ScoLsB73s 15792722 10720114 11278843 6968833 181 E: .02E0 Ident: 14/73 Ident% 19 Q: 175-241 (157)   S: 2-74 (181) Probable nicotinate-nucleotide adenylyltransferase (Deamido-NAD(+) pyrophosphorylase) (Deamido-NAD(+) diphosphorylase) (Nicotinate mononucleotide adenylyltransferase) (NAMN adenylyltransferase) Pos: 29/73 Gap: 6/73 u+fx1AyETCvLooiC5vNFH8nULuk 15640700 11278400 9655120 322 E: .98E0 Ident: 34/183 Ident% 18 Q: 181-354 (157)   S: 22-184 (322) riboflavin kinase/FMN adenylyltransferase [Vibrio cholerae] riboflavin kinase/FMN adenylyltransferase [Vibrio cholerae] riboflavin kinase/FMN adenylyltransferase VC0681 [imported] - Vibrio cholerae (group O1 strain N16961) riboflavin kinase/FMN adenylyltransferase VC0681 [imported] - Vibrio cholerae (group O1 strain N16961) riboflavin kinase/FMN adenylyltransferase [Vibrio cholerae] riboflavin kinase/FMN adenylyltransferase [Vibrio cholerae] Pos: 69/183 Gap: 29/183 0gazFgvsQF8LCjjmMLMMqGwZEuc 17987876 17983609 293 E: .35E0 Ident: 11/54 Ident% 20 Q: 159-212 (157)   S: 7-59 (293) PANTOATE-BETA-ALANINE LIGASE [Brucella melitensis] PANTOATE-BETA-ALANINE LIGASE [Brucella melitensis] Pos: 22/54 Gap: 1/54 qKr3MqsgAeRFZkokIseSNSUmfPQ 16765971 16421201 886 E: .25E0 Ident: 25/119 Ident% 21 Q: 47-150 (157)   S: 756-874 (886) putative acetyl-CoA synthetase [Salmonella typhimurium LT2] putative acetyl-CoA synthetase [Salmonella typhimurium LT2] Pos: 42/119 Gap: 15/119 4BM7OzgE4YcHhMIfASmfDl92j3E 11498346 7451123 2649875 162 E: 3.8E0 Ident: 20/100 Ident% 20 Q: 67-150 (157)   S: 48-147 (162) ribosomal protein S18 alanine acetyltransferase [Archaeoglobus fulgidus] ribosomal protein S18 alanine acetyltransferase homolog - Archaeoglobus fulgidus ribosomal protein S18 alanine acetyltransferase [Archaeoglobus fulgidus] Pos: 34/100 Gap: 16/100 Lko8pT9egD1E/Xwa/qoyA8o8d/U 15834065 16131728 418490 541125 304992 1790321 13364287 329 E: .015E0 Ident: 17/83 Ident% 20 Q: 62-139 (157)   S: 56-138 (329) putative acetyltransferase [Escherichia coli O157:H7] putative acetyltransferase (EC 2.3.1.18) [Escherichia coli K12] putative acetyltransferase (EC 2.3.1.18) [Escherichia coli K12] putative acetyltransferase [Escherichia coli O157:H7] Pos: 33/83 Gap: 5/83 f8b5Llr+15ASj8Anh0J5eR1bSDk 13473418 14024167 195 E: .46E0 Ident: 17/77 Ident% 22 Q: 173-242 (157)   S: 7-82 (195) NICOTINATE-NUCLEOTIDE ADENYLYLTRANSFERASE [Mesorhizobium loti] nicotinate-nucleotide adenylyltransferase [Mesorhizobium loti] Pos: 28/77 Gap: 8/77 7XObKAb/rKLb8FYOkZBIWHShGB0 6138860 161 E: 1.5E0 Ident: 18/66 Ident% 27 Q: 80-141 (157)   S: 73-138 (161) putative acetyltransferase. [Streptomyces coelicolor A3(2)] Pos: 29/66 Gap: 4/66 CfS30pzoaj+yrDCcH/wNLq8+Gmk 15606021 7451124 2983204 154 E: 1.2E0 Ident: 28/126 Ident% 22 Q: 31-154 (157)   S: 23-136 (154) ribosomal-protein-alanine acetyltransferase [Aquifex aeolicus] ribosomal-protein-alanine acetyltransferase - Aquifex aeolicus ribosomal-protein-alanine acetyltransferase [Aquifex aeolicus] Pos: 48/126 Gap: 14/126 gsCx7ZXIezChe17Sbe92vfJf1fw 15894544 15024189 200 E: .002E0 Ident: 34/212 Ident% 16 Q: 174-365 (157)   S: 2-196 (200) Predicted nucleotidyltransferases of NarD/TagD family (N-term. domain) , yqeJ ortholog [Clostridium acetobutylicum] Predicted nucleotidyltransferases of NarD/TagD family (N-term. domain) , yqeJ ortholog [Clostridium acetobutylicum] Pos: 64/212 Gap: 37/212 +yw2fM2agUAIiWgLYlCLizTV0v4 7705823 5114045 12843892 13528756 14250083 14318731 178 E: 4.4E0 Ident: 17/100 Ident% 17 Q: 66-150 (157)   S: 41-139 (178) N-terminal acetyltransferase complex ard1subunit [Homo sapiens] N-terminal acetyltransferase complex ard1 subunit [Homo sapiens] data source:SPTR, source key:Q9Y6D2, evidence:ISS~homolog to N-TERMINAL ACETYLTRANSFERASE COMPLEX ARD1 SUBUNIT (N-TERMINAL ACETYLTRANSFERASE COMPLEX ARD1SUBUNIT)~putative [Mus musculus] N-terminal acetyltransferase complex ard1subunit [Homo sapiens] N-terminal acetyltransferase complex ard1subunit [Homo sapiens] N-terminal acetyltransferase complex ard1subunit [Mus musculus] Pos: 38/100 Gap: 16/100 XGI3cEtnS3r44mCEkp6KANOU1Mw 15891287 17937363 15159662 17742071 128 E: .58E0 Ident: 16/78 Ident% 20 Q: 69-141 (157)   S: 42-119 (128) acetyltransferase [Agrobacterium tumefaciens str. C58 (U. Washington)] acetyltransferase [Agrobacterium tumefaciens str. C58 (U. Washington)] Pos: 33/78 Gap: 5/78 7eUQRJjFvvPXQDBB659gJiYu8+s 16763353 16505662 148 E: .18E0 Ident: 13/65 Ident% 20 Q: 88-149 (157)   S: 66-130 (148) ribosomal-protein-alanine acetyltransferase [Salmonella enterica subsp. enterica serovar Typhi] ribosomal-protein-alanine acetyltransferase [Salmonella enterica subsp. enterica serovar Typhi] Pos: 24/65 Gap: 3/65 t3oDRI879J55RSnqC3g1GQQjgSg 9296975 4115735 149 E: .046E0 Ident: 17/73 Ident% 23 Q: 68-140 (157)   S: 68-139 (149) Glucosamine-phosphate N-acetyltransferase (Phosphoglucosamine transacetylase) (Phosphoglucosamine acetylase) acetyltransferase [Candida albicans] Pos: 34/73 Gap: 1/73 wlQiyEvhBkAiCZTxKna9k4mOP8g 1174253 275 E: 1.3E0 Ident: 11/55 Ident% 20 Q: 158-212 (157)   S: 9-58 (275) pantothenate synthetase [Synechocystis sp.] Pos: 21/55 Gap: 5/55 yr3a/RZxeg6T7QXSNWtwdAaLneo 16119372 17938731 5508827 15161896 17743575 159 E: 5.8E0 Ident: 13/72 Ident% 18 Q: 75-143 (157)   S: 75-144 (159) acetyltransferase [Agrobacterium tumefaciens str. C58 (Dupont)] [Agrobacterium tumefaciens str. C58 (U. Washington)] acetyltransferase [Agrobacterium tumefaciens str. C58 (U. Washington)] Pos: 27/72 Gap: 5/72 0RhtBplIJY5kXIW+NBqNVkx5XVo 16801247 16414695 151 E: 2E0 Ident: 16/81 Ident% 19 Q: 67-139 (157)   S: 48-127 (151) similar to ribosomal protein alanine acetyltransferase [Listeria innocua] similar to ribosomal protein alanine acetyltransferase [Listeria innocua] Pos: 35/81 Gap: 9/81 1Rf48oRiVKcw1pYqb/Ao8Mzaup0 18309921 18144599 170 E: .77E0 Ident: 22/138 Ident% 15 Q: 43-151 (157)   S: 26-163 (170) probable acetyltransferase [Clostridium perfringens] probable acetyltransferase [Clostridium perfringens] Pos: 48/138 Gap: 29/138 HMnah8pq0/vaY7V53kVqmNdS+k8 15890027 17936653 15158002 17741294 207 E: 2.6E0 Ident: 21/94 Ident% 22 Q: 163-247 (157)   S: 9-101 (207) nicotinate-nucleotide adenylyltransferase [Agrobacterium tumefaciens str. C58 (U. Washington)] nicotinate-nucleotide adenylyltransferase [Agrobacterium tumefaciens str. C58 (U. Washington)] Pos: 34/94 Gap: 10/94 uR07O/vyAtvvG6CnWH3bbhQ4Z2Q 15600189 11350566 9951281 474 E: .72E0 Ident: 29/165 Ident% 17 Q: 153-303 (157)   S: 318-470 (474) LPS biosynthesis protein RfaE [Pseudomonas aeruginosa] LPS biosynthesis protein RfaE PA4996 [imported] - Pseudomonas aeruginosa (strain PAO1) LPS biosynthesis protein RfaE [Pseudomonas aeruginosa] Pos: 52/165 Gap: 26/165 XtzN9XdjT9VY5DzgCe7Vk2F0CCo 16129407 8480658 7427901 1787719 172 E: .41E0 Ident: 14/67 Ident% 20 Q: 87-149 (157)   S: 81-146 (172) HYPOTHETICAL ACETYLTRANSFERASE YNCA probable phosphinothricin N-acetyltransferase (EC 2.3.1.-) - Escherichia coli Pos: 25/67 Gap: 5/67 urDcsmf0aVMpcEHEziGgVeeENH4 10720123 178 E: .44E0 Ident: 12/59 Ident% 20 Q: 177-230 (157)   S: 3-61 (178) Nicotinamide-nucleotide adenylyltransferase (NAD(+) pyrophosphorylase) (NAD(+) diphosphorylase) (NMN adenylyltransferase) Pos: 23/59 Gap: 5/59 M9cYfAf9JZgUUnynMLA3LQscrhk 17545969 17428264 451 E: .013E0 Ident: 16/95 Ident% 16 Q: 51-139 (157)   S: 329-422 (451) PROBABLE AMINO-ACID ACETYLTRANSFERASE PROTEIN [Ralstonia solanacearum] PROBABLE AMINO-ACID ACETYLTRANSFERASE PROTEIN [Ralstonia solanacearum] Pos: 31/95 Gap: 7/95 hx/6OjXmr4y3KzWBT8ZcIpdJIbs 15610556 15843016 7451126 1449367 13883358 158 E: .7E0 Ident: 13/50 Ident% 26 Q: 91-139 (157)   S: 82-130 (158) acetyltransferase, GNAT family [Mycobacterium tuberculosis CDC1551] acetyltransferase, GNAT family [Mycobacterium tuberculosis CDC1551] Pos: 24/50 Gap: 2/50 kUPiypPU1+LXQ8sN50suNnSs1gI 16128126 400728 7449518 14488684 14488685 304928 1786325 283 E: 2E0 Ident: 8/50 Ident% 16 Q: 163-212 (157)   S: 11-59 (283) pantothenate synthetase [Escherichia coli K12] Pantoate--beta-alanine ligase (Pantothenate synthetase) (Pantoate activating enzyme) Pantoate--beta-alanine ligase (Pantothenate synthetase) (Pantoate activating enzyme) pantoate--beta-alanine ligase (EC 6.3.2.1) - Escherichia coli Chain A, Crystal Apo-Structure Of Pantothenate Synthetase From E. Coli Chain B, Crystal Apo-Structure Of Pantothenate Synthetase From E. Coli pantothenate synthetase [Escherichia coli] pantothenate synthetase [Escherichia coli K12] Pos: 22/50 Gap: 1/50 IcY69HGfOKP4KIHQrQ8So12JJHY 15896095 15025884 146 E: .054E0 Ident: 17/80 Ident% 21 Q: 69-141 (157)   S: 46-125 (146) Predicted acetyltransferase [Clostridium acetobutylicum] Predicted acetyltransferase [Clostridium acetobutylicum] Pos: 35/80 Gap: 7/80 2X5bdTrZTWHJIOos6zP9eUb1r3I 15612321 10720117 7445447 4155870 174 E: .059E0 Ident: 8/74 Ident% 10 Q: 174-241 (157)   S: 11-84 (174) Probable nicotinate-nucleotide adenylyltransferase (Deamido-NAD(+) pyrophosphorylase) (Deamido-NAD(+) diphosphorylase) (Nicotinate mononucleotide adenylyltransferase) (NAMN adenylyltransferase) Pos: 26/74 Gap: 6/74 gAxCE91RYlmCyxN7NtF9DJxx70E 14590375 10720125 7450069 3256867 186 E: .54E0 Ident: 10/62 Ident% 16 Q: 177-230 (157)   S: 4-62 (186) Nicotinamide-nucleotide adenylyltransferase (NAD(+) pyrophosphorylase) (NAD(+) diphosphorylase) (NMN adenylyltransferase) Pos: 24/62 Gap: 11/62 1siIJE88eD2SHW7F5i87A5OUv9c 15606564 7514956 2983785 168 E: .007E0 Ident: 15/60 Ident% 25 Q: 174-226 (157)   S: 5-64 (168) glycerol-3-phosphate cytidyltransferase [Aquifex aeolicus] glycerol-3-phosphate cytidyltransferase - Aquifex aeolicus glycerol-3-phosphate cytidyltransferase [Aquifex aeolicus] Pos: 27/60 Gap: 7/60 +mFst+h9C+1UaykMlZA0mfADFkU 14603223 389 E: 5.2E0 Ident: 17/92 Ident% 18 Q: 172-253 (157)   S: 17-105 (389) phosphate cytidylyltransferase 2, ethanolamine [Homo sapiens] phosphate cytidylyltransferase 2, ethanolamine [Homo sapiens] Pos: 33/92 Gap: 13/92 JppePb/STdzvvFzdRS/SM8Sy8Iw 15789942 10580352 146 E: 1.5E0 Ident: 9/33 Ident% 27 Q: 181-213 (157)   S: 8-40 (146) glycerol-3-phosphate cytidyltransferase; TaqD [Halobacterium sp. NRC-1] glycerol-3-phosphate cytidyltransferase; TaqD [Halobacterium sp. NRC-1] Pos: 17/33 Gap: -1/-1 4LhGe8KHJATplK1H81ztN3kzkEw 15896168 15025965 281 E: .05E0 Ident: 13/53 Ident% 24 Q: 160-212 (157)   S: 11-59 (281) Pantoate--beta-alanine ligase [Clostridium acetobutylicum] Pantoate--beta-alanine ligase [Clostridium acetobutylicum] Pos: 24/53 Gap: 4/53 JZbdEnNAMyRg6C/XWS29qqd+tZc 8134620 3282095 280 E: 4.3E0 Ident: 12/54 Ident% 22 Q: 167-220 (157)   S: 15-67 (280) Pantoate--beta-alanine ligase (Pantothenate synthetase) (Pantoate activating enzyme) Pantoate--beta-alanine ligase (Pantothenate synthetase) (Pantoate activating enzyme) Pos: 23/54 Gap: 1/54 FMsYs9rS8zbQ8fNvCUTqgbFy2Mk 16330757 7470762 1653250 513 E: 2.6E0 Ident: 11/55 Ident% 20 Q: 158-212 (157)   S: 10-59 (513) pantothenate synthetase/cytidylate kinase [Synechocystis sp. PCC 6803] pantothenate synthetase/cytidylate kinase [Synechocystis sp. PCC 6803] pantothenate synthetase panC - Synechocystis sp. (strain PCC 6803) pantothenate synthetase/cytidylate kinase [Synechocystis sp. PCC 6803] pantothenate synthetase/cytidylate kinase [Synechocystis sp. PCC 6803] Pos: 21/55 Gap: 5/55 reDh/hW5a1xzDPTJrb9g0vHfvzE 15895801 15025561 149 E: 5.3E0 Ident: 12/92 Ident% 13 Q: 67-149 (157)   S: 48-136 (149) Predicted acetyltransferase [Clostridium acetobutylicum] Predicted acetyltransferase [Clostridium acetobutylicum] Pos: 38/92 Gap: 12/92 4DMRaRgq31E6Q1+veBWtfdtxsU4 16760289 16502584 171 E: .038E0 Ident: 15/68 Ident% 22 Q: 87-150 (157)   S: 81-147 (171) putative acetyltransferase [Salmonella enterica subsp. enterica serovar Typhi] putative acetyltransferase [Salmonella enterica subsp. enterica serovar Typhi] Pos: 26/68 Gap: 5/68 iOk7XJIrR3mdlLMR9gjuC8gObXA 15613889 14194966 10173942 207 E: .082E0 Ident: 13/65 Ident% 20 Q: 174-231 (157)   S: 2-66 (207) nicotinate-nucleotide adenylyltransferase [Bacillus halodurans] Probable nicotinate-nucleotide adenylyltransferase (Deamido-NAD(+) pyrophosphorylase) (Deamido-NAD(+) diphosphorylase) (Nicotinate mononucleotide adenylyltransferase) (NAMN adenylyltransferase) nicotinate-nucleotide adenylyltransferase [Bacillus halodurans] Pos: 24/65 Gap: 7/65 gR+D5ia2BtPv3MXER7/BJL/4dUg 17937190 17741883 292 E: 2.9E0 Ident: 12/45 Ident% 26 Q: 169-212 (157)   S: 17-59 (292) pantoate--beta-alanine ligase [Agrobacterium tumefaciens str. C58 (U. Washington)] pantoate--beta-alanine ligase [Agrobacterium tumefaciens str. C58 (U. Washington)] Pos: 18/45 Gap: 3/45 S2EzGkhIEgKM8OJXkdpD+SOXwLI 15598564 11350862 9949503 221 E: 2.8E0 Ident: 15/91 Ident% 16 Q: 65-139 (157)   S: 121-209 (221) probable acetyltransferase [Pseudomonas aeruginosa] probable acetyltransferase PA3368 [imported] - Pseudomonas aeruginosa (strain PAO1) probable acetyltransferase [Pseudomonas aeruginosa] Pos: 30/91 Gap: 18/91 Cre99d62B6q8obCspQqa07P/m6M 15800353 15829931 12513543 13360135 213 E: .13E0 Ident: 38/215 Ident% 17 Q: 177-364 (157)   S: 6-208 (213) nicotinic acid mononucleotide adenylyltransferase [Escherichia coli O157:H7] nicotinic acid mononucleotide adenylyltransferase [Escherichia coli O157:H7] Pos: 63/215 Gap: 39/215 uTODxmb3jN3M8XSNj/3MSI3h4lw 15639728 10720118 7430071 3323048 204 E: 4.7E0 Ident: 10/63 Ident% 15 Q: 175-229 (157)   S: 2-63 (204) Probable nicotinate-nucleotide adenylyltransferase (Deamido-NAD(+) pyrophosphorylase) (Deamido-NAD(+) diphosphorylase) (Nicotinate mononucleotide adenylyltransferase) (NAMN adenylyltransferase) Pos: 20/63 Gap: 9/63 TMhwhdrT1M85pSc/vgIpl7PNu1s 6325307 417272 322940 171882 805033 1314121 176 E: 2.5E0 Ident: 14/52 Ident% 26 Q: 91-139 (157)   S: 84-135 (176) N-acetyltransferase; Mak3p [Saccharomyces cerevisiae] L-A VIRUS GAG PROTEIN N-ACETYLTRANSFERASE probable N-acetyltransferase MAK3 - yeast (Saccharomyces cerevisiae) N-acetyltransferase [Saccharomyces cerevisiae] Pos: 23/52 Gap: 3/52 KV6/2wgi5nBOwas8Go24v22mIsQ 15598656 11350863 9949602 585 E: 5.2E0 Ident: 14/62 Ident% 22 Q: 85-143 (157)   S: 191-252 (585) probable acetyltransferase [Pseudomonas aeruginosa] probable acetyltransferase PA3460 [imported] - Pseudomonas aeruginosa (strain PAO1) probable acetyltransferase [Pseudomonas aeruginosa] Pos: 27/62 Gap: 3/62 ySAJAR6tm6M/KypJUOXuum3RHGU 13129435 742 E: 8.2E0 Ident: 9/39 Ident% 23 Q: 170-208 (157)   S: 614-652 (742) Putative phospholipid cytidylyltransferase [Oryza sativa] Putative phospholipid cytidylyltransferase [Oryza sativa] Pos: 18/39 Gap: -1/-1 huhL+tR3phviGD6q319Rps77Q2s 13385922 12836863 188 E: 9.4E0 Ident: 14/80 Ident% 17 Q: 79-150 (157)   S: 71-149 (188) RIKEN cDNA 1500004D14 [Mus musculus] data source:SPTR, source key:Q9Y6D2, evidence:ISS~homolog to N-TERMINAL ACETYLTRANSFERASE COMPLEX ARD1 SUBUNIT (N-TERMINAL ACETYLTRANSFERASE COMPLEX ARD1SUBUNIT)~putative [Mus musculus] Pos: 33/80 Gap: 9/80 HDoheQ+5Ne/3QJtAzEQoJookijQ 16123429 15981206 880 E: .15E0 Ident: 23/122 Ident% 18 Q: 47-153 (157)   S: 756-877 (880) putative acetyltransferase [Yersinia pestis] putative acetyltransferase [Yersinia pestis] Pos: 43/122 Gap: 15/122 x9FZwgfkxTWZGqFY6v64VZWBiUM 16080627 135274 477627 6137341 6137342 143723 402852 2636100 129 E: .15E0 Ident: 13/68 Ident% 19 Q: 175-235 (157)   S: 2-68 (129) glycerol-3-phosphate cytidylyltransferase [Bacillus subtilis] Glycerol-3-phosphate cytidylyltransferase (GCT) (CDP-glycerol pyrophosphorylase) (Teichoic acid biosynthesis protein D) Glycerol-3-phosphate cytidylyltransferase (GCT) (CDP-glycerol pyrophosphorylase) (Teichoic acid biosynthesis protein D) glycerol-3-phosphate cytidylyltransferase (EC 2.7.7.39) tagD - Bacillus subtilis Chain A, Ctp:glycerol-3-Phosphate Cytidylyltransferase From Bacillus Subtilis Chain B, Ctp:glycerol-3-Phosphate Cytidylyltransferase From Bacillus Subtilis CTP:glycerol-3-phosphate cytidylyltransferase, GCTase [Bacillus subtilis, BR151, Peptide, 129 aa] glycerol-3-phosphate cytidylyltransferase [Bacillus subtilis] Pos: 26/68 Gap: 8/68 sQZGQrowxl56fRFiOWxK1c/uLXI 16126883 13424227 229 E: 2.6E0 Ident: 21/81 Ident% 25 Q: 67-139 (157)   S: 134-213 (229) acetyltransferase, GNAT family [Caulobacter crescentus] acetyltransferase, GNAT family [Caulobacter crescentus] Pos: 31/81 Gap: 9/81 sOwupqmFeJJaUfWbmNNC1k7Lsvc 16804115 16411546 151 E: 1.3E0 Ident: 16/81 Ident% 19 Q: 67-139 (157)   S: 48-127 (151) similar to ribosomal protein alanine acetyltransferase [Listeria monocytogenes EGD-e] similar to ribosomal protein alanine acetyltransferase [Listeria monocytogenes] Pos: 34/81 Gap: 9/81 OUQaKfEguMSkbdPWctN06kTfHzg 15804944 15834585 16132191 2851584 7430410 2367381 12519396 13364809 148 E: .024E0 Ident: 13/65 Ident% 20 Q: 88-149 (157)   S: 66-130 (148) acyltransferase for 30S ribosomal subunit protein S18; acetylation of N-terminal alanine [Escherichia coli O157:H7 EDL933] acyltransferase for 30S ribosomal subunit protein S18 [Escherichia coli O157:H7] acyltransferase for 30S ribosomal subunit protein S18; acetylation of N-terminal alanine [Escherichia coli K12] Ribosomal-protein-alanine acetyltransferase (Acetylating enzyme for N-terminal of ribosomal protein S18) ribosomal-protein-alanine N-acetyltransferase (EC 2.3.1.128) rimI - Escherichia coli (strain K-12) acyltransferase for 30S ribosomal subunit protein S18; acetylation of N-terminal alanine [Escherichia coli K12] acyltransferase for 30S ribosomal subunit protein S18; acetylation of N-terminal alanine [Escherichia coli O157:H7 EDL933] acyltransferase for 30S ribosomal subunit protein S18 [Escherichia coli O157:H7] Pos: 25/65 Gap: 3/65 83G6YAzZlStqc8jIYTQWH99x3ZY 16759173 16501463 284 E: 3.1E0 Ident: 8/45 Ident% 17 Q: 168-212 (157)   S: 16-59 (284) pantoate:beta-alanine ligase [Salmonella enterica subsp. enterica serovar Typhi] pantoate:beta-alanine ligase [Salmonella enterica subsp. enterica serovar Typhi] Pos: 19/45 Gap: 1/45 SCmivnW15RNHHMBYnSdcLnocnCw 15645950 10720106 7445446 2314504 174 E: .67E0 Ident: 8/74 Ident% 10 Q: 174-241 (157)   S: 11-84 (174) Probable nicotinate-nucleotide adenylyltransferase (Deamido-NAD(+) pyrophosphorylase) (Deamido-NAD(+) diphosphorylase) (Nicotinate mononucleotide adenylyltransferase) (NAMN adenylyltransferase) Pos: 23/74 Gap: 6/74 Ol7AZaL/iBAd5EZjNf3fOlxQrQ0 15640612 13431777 11279931 9655022 293 E: 1E0 Ident: 8/54 Ident% 14 Q: 159-212 (157)   S: 7-59 (293) pantoate--beta-alanine ligase [Vibrio cholerae] Pantoate--beta-alanine ligase (Pantothenate synthetase) (Pantoate activating enzyme) Pantoate--beta-alanine ligase (Pantothenate synthetase) (Pantoate activating enzyme) pantoate--beta-alanine ligase VC0591 [imported] - Vibrio cholerae (group O1 strain N16961) pantoate--beta-alanine ligase [Vibrio cholerae] Pos: 21/54 Gap: 1/54 ndzSYYumIbJuD3x9jHHWBQSr3nA 1125683 1125687 1262138 132 E: .28E0 Ident: 13/59 Ident% 22 Q: 175-226 (157)   S: 2-60 (132) glycerol-3-phosphate cytidyltransferase [Staphylococcus aureus] glycerol-3-phosphate cytidyltransferase [Staphylococcus aureus] glycerol 3-phosphate cytidyltransferase [Staphylococcus aureus] Pos: 22/59 Gap: 7/59 aJsD3W7aDVJOaBjGgLe6lUtVY6M 13541676 178 E: .52E0 Ident: 5/32 Ident% 15 Q: 177-208 (157)   S: 9-40 (178) Nicotinamide mononucleotide adenylyltransferase [Thermoplasma volcanium] Pos: 15/32 Gap: -1/-1 ++JaKj6PzDOgjkZ+fVOyp9VDt4A 15805703 7473387 6458376 152 E: .56E0 Ident: 13/85 Ident% 15 Q: 71-141 (157)   S: 57-141 (152) acetyltransferase, putative [Deinococcus radiodurans] probable acetyltransferase - Deinococcus radiodurans (strain R1) acetyltransferase, putative [Deinococcus radiodurans] Pos: 29/85 Gap: 14/85 RbuZXJypMD0rFHz1bBzfEa0xPLk 16128622 1723307 7430072 727430 1778557 1786858 4062257 213 E: .084E0 Ident: 38/215 Ident% 17 Q: 177-364 (157)   S: 6-208 (213) Nicotinate-nucleotide adenylyltransferase (Deamido-NAD(+) pyrophosphorylase) (Deamido-NAD(+) diphosphorylase) (Nicotinate mononucleotide adenylyltransferase) (NAMN adenylyltransferase) Pos: 63/215 Gap: 39/215 329EEqJVzbYc9PEesxMMwpZanm4 15668721 2496030 2128367 1591245 168 E: .004E0 Ident: 13/62 Ident% 20 Q: 177-233 (157)   S: 3-64 (168) Nicotinamide-nucleotide adenylyltransferase (NAD(+) pyrophosphorylase) (NAD(+) diphosphorylase) (NMN adenylyltransferase) Pos: 26/62 Gap: 5/62 PWUjyTl4vOgKRp6LLSj8LUYeRGU 15642872 10720122 7445445 4980587 205 E: .002E0 Ident: 13/71 Ident% 18 Q: 172-237 (157)   S: 12-82 (205) Probable nicotinate-nucleotide adenylyltransferase (Deamido-NAD(+) pyrophosphorylase) (Deamido-NAD(+) diphosphorylase) (Nicotinate mononucleotide adenylyltransferase) (NAMN adenylyltransferase) Pos: 27/71 Gap: 5/71 3eDXj7VW7BmxI2f5QhQr8/qa17k 16763571 16418683 284 E: 3.2E0 Ident: 8/45 Ident% 17 Q: 168-212 (157)   S: 16-59 (284) pantothenate synthetase [Salmonella typhimurium LT2] pantothenate synthetase [Salmonella typhimurium LT2] Pos: 19/45 Gap: 1/45 BVpxgcA/xnlROnuuElwwwkn0YWY 16802440 16409773 141 E: .36E0 Ident: 14/59 Ident% 23 Q: 91-145 (157)   S: 69-124 (141) weakly similar to blasticidin S-acetyltransferase [Listeria monocytogenes EGD-e] weakly similar to blasticidin S-acetyltransferase [Listeria monocytogenes] Pos: 25/59 Gap: 7/59 EjvlrTCuL8pTNnAtQdaIaOXY45g 17936143 17740734 189 E: 2.1E0 Ident: 16/84 Ident% 19 Q: 68-143 (157)   S: 51-130 (189) acetyltransferase [Agrobacterium tumefaciens str. C58 (U. Washington)] acetyltransferase [Agrobacterium tumefaciens str. C58 (U. Washington)] Pos: 31/84 Gap: 12/84 SvwUjZofLcVZv24ORf6YCiA8N9k 16761509 16503810 886 E: .15E0 Ident: 25/119 Ident% 21 Q: 47-150 (157)   S: 756-874 (886) putative acyl-CoA synthetase [Salmonella enterica subsp. enterica serovar Typhi] putative acyl-CoA synthetase [Salmonella enterica subsp. enterica serovar Typhi] Pos: 42/119 Gap: 15/119 ivEEdYyX0X6y+a/GqK7VKcIXmDE 16761367 16503666 141 E: .035E0 Ident: 14/75 Ident% 18 Q: 60-130 (157)   S: 37-111 (141) putative acetyltransferase [Salmonella enterica subsp. enterica serovar Typhi] putative acetyltransferase [Salmonella enterica subsp. enterica serovar Typhi] Pos: 27/75 Gap: 4/75 9+cx1NYfQNDUdG5WmmTQg/r8X3g 16079299 1709569 7449521 1146241 2634660 286 E: 7.3E0 Ident: 15/65 Ident% 23 Q: 157-220 (157)   S: 5-67 (286) pantothenate synthetase [Bacillus subtilis] Pantoate--beta-alanine ligase (Pantothenate synthetase) (Pantoate activating enzyme) Pantoate--beta-alanine ligase (Pantothenate synthetase) (Pantoate activating enzyme) pantothenate synthetase panC - Bacillus subtilis pantothenate synthetase [Bacillus subtilis] pantothenate synthetase [Bacillus subtilis] Pos: 28/65 Gap: 3/65 0nmIs+Ko8nSn/vdzS4/C7M9689M 6562780 155 E: .49E0 Ident: 17/59 Ident% 28 Q: 81-139 (157)   S: 86-143 (155) putative acetyltransferase [Streptomyces coelicolor] Pos: 25/59 Gap: 1/59 FEf0hRduZElg7+UOlA/nhYeCmNs 14775140 358 E: 5.6E0 Ident: 20/112 Ident% 17 Q: 98-206 (157)   S: 140-245 (358) phosphate cytidylyltransferase 2, ethanolamine [Homo sapiens] phosphate cytidylyltransferase 2, ethanolamine [Homo sapiens] Pos: 42/112 Gap: 9/112 myP3ECowEH/SszMtxoI1CMsPo54 15923631 15926318 1913907 13700532 14246410 132 E: .27E0 Ident: 13/59 Ident% 22 Q: 175-226 (157)   S: 2-60 (132) teichoic acid biosynthesis protein D [Staphylococcus aureus subsp. aureus Mu50] teichoic acid biosynthesis protein D [Staphylococcus aureus subsp. aureus N315] teichoic acid biosynthesis protein D [Staphylococcus aureus subsp. aureus N315] teichoic acid biosynthesis protein D [Staphylococcus aureus subsp. aureus Mu50] Pos: 22/59 Gap: 7/59 33qam9IwJyWpfjGETOZdeD4zgBw 16762405 16767294 16422592 16504709 329 E: .021E0 Ident: 18/83 Ident% 21 Q: 62-139 (157)   S: 56-138 (329) putative acetyltransferase [Salmonella enterica subsp. enterica serovar Typhi] putative acetyltransferase [Salmonella typhimurium LT2] putative acetyltransferase [Salmonella typhimurium LT2] putative acetyltransferase [Salmonella enterica subsp. enterica serovar Typhi] Pos: 35/83 Gap: 5/83 2aDvIvadfpt5611uaF62U3BnAHw 14318503 1175928 1084684 836737 4115733 159 E: .013E0 Ident: 15/65 Ident% 23 Q: 76-140 (157)   S: 86-149 (159) involved in UDP-N-acetylglucosamine biosynthesis; Gna1p [Saccharomyces cerevisiae] Glucosamine-phosphate N-acetyltransferase (Phosphoglucosamine transacetylase) (Phosphoglucosamine acetylase) glucosamine-phosphate N-acetyltransferase (EC 2.3.1.4) [validated] - yeast (Saccharomyces cerevisiae) acetyltransferase [Saccharomyces cerevisiae] Pos: 33/65 Gap: 1/65 LyizeEAroUosVNdgGsFjKJiZtrE 15806183 9978485 7473264 6458903 281 E: 2.6E0 Ident: 13/48 Ident% 27 Q: 174-220 (157)   S: 9-54 (281) pantoate--beta-alanine ligase [Deinococcus radiodurans] Pantoate--beta-alanine ligase (Pantothenate synthetase) (Pantoate activating enzyme) Pantoate--beta-alanine ligase (Pantothenate synthetase) (Pantoate activating enzyme) pantoate--beta-alanine ligase - Deinococcus radiodurans (strain R1) pantoate--beta-alanine ligase [Deinococcus radiodurans] Pos: 22/48 Gap: 3/48 Lpxumi/uu3Bl7EElrN+pZR7/B+o 6946675 228 E: .49E0 Ident: 15/105 Ident% 14 Q: 36-139 (157)   S: 89-175 (228) /prediction=(method:''genefinder'', version:''084'', score:''48.06''); /prediction=(method:''genscan'', version:''1.0'', score:''132.90''); /match=(desc:''N-ACETYLTRANSFERASE'', species:''Drosophila melanogaster (Fruit fly)'', ranges:(query: Pos: 39/105 Gap: 19/105 ESM+o1Dsvqx0yfy7V0J2RmPiCIY 18892429 188 E: .29E0 Ident: 11/63 Ident% 17 Q: 175-229 (157)   S: 2-61 (188) nucleotidyltransferase [Pyrococcus furiosus DSM 3638] Pos: 24/63 Gap: 11/63 RryDEVp01QU6GUPrO6nRMXsTcXg 14521772 10720130 7450073 5458992 186 E: .46E0 Ident: 10/62 Ident% 16 Q: 177-230 (157)   S: 4-62 (186) Nicotinamide-nucleotide adenylyltransferase (NAD(+) pyrophosphorylase) (NAD(+) diphosphorylase) (NMN adenylyltransferase) Pos: 24/62 Gap: 11/62 6LOut5GMahFYgMUz7nUly4V1DPM 16120762 15978525 147 E: .37E0 Ident: 12/65 Ident% 18 Q: 88-149 (157)   S: 66-130 (147) ribosomal-protein-alanine acetyltransferase [Yersinia pestis] ribosomal-protein-alanine acetyltransferase [Yersinia pestis] Pos: 24/65 Gap: 3/65 xWGV7Aga766svAclENTFkCcsuPw 16765769 16420989 178 E: .048E0 Ident: 14/75 Ident% 18 Q: 60-130 (157)   S: 74-148 (178) putative acetyltransferase [Salmonella typhimurium LT2] putative acetyltransferase [Salmonella typhimurium LT2] Pos: 27/75 Gap: 4/75 bHFhBFbO+hYxB1I+UnR05oqKvHg 6752369 184 E: .41E0 Ident: 15/96 Ident% 15 Q: 61-141 (157)   S: 62-152 (184) putative acetyltransferase [Streptomyces coelicolor A3(2)] Pos: 30/96 Gap: 20/96 d/ano4dIHZ31P98bN/Zzpiae3JI 15827763 14194960 13093315 214 E: 3.5E0 Ident: 19/79 Ident% 24 Q: 181-253 (157)   S: 3-77 (214) Probable nicotinate-nucleotide adenylyltransferase (Deamido-NAD(+) pyrophosphorylase) (Deamido-NAD(+) diphosphorylase) (Nicotinate mononucleotide adenylyltransferase) (NAMN adenylyltransferase) Pos: 26/79 Gap: 10/79 ast/IIHl+nPi99a1KYLkMZZO9bM 16800145 16413535 127 E: .13E0 Ident: 10/71 Ident% 14 Q: 175-239 (157)   S: 2-72 (127) highly similar to glycerol-3-phosphate cytidylyltransferase (gct), CDP-glycerol pyrophosphorylase (teichoic acid biosynthesis protein D) [Listeria innocua] highly similar to glycerol-3-phosphate cytidylyltransferase (gct), CDP-glycerol pyrophosphorylase (teichoic acid biosynthesis protein D) [Listeria innocua] highly similar to glycerol-3-phosphate cytidylyltransferase (gct), CDP-glycerol pyrophosphorylase (teichoic acid biosynthesis protein D) [Listeria innocua] highly similar to glycerol-3-phosphate cytidylyltransferase (gct), CDP-glycerol pyrophosphorylase (teichoic acid biosynthesis protein D) [Listeria innocua] Pos: 25/71 Gap: 6/71 pLSTZ+9D16wFRgiJo1gjKmqoUPE 16767431 17865783 16422736 145 E: 6.3E0 Ident: 15/72 Ident% 20 Q: 69-140 (157)   S: 54-123 (145) putative acetyltransferase [Salmonella typhimurium LT2] Hypothetical acetyltransferase yjaB putative acetyltransferase [Salmonella typhimurium LT2] Pos: 29/72 Gap: 2/72 ApYX7/v7pQJ3jzUxYXO4hQp4aqY 15673081 14194961 12724056 195 E: .49E0 Ident: 36/201 Ident% 17 Q: 174-362 (157)   S: 7-186 (195) Probable nicotinate-nucleotide adenylyltransferase (Deamido-NAD(+) pyrophosphorylase) (Deamido-NAD(+) diphosphorylase) (Nicotinate mononucleotide adenylyltransferase) (NAMN adenylyltransferase) Pos: 69/201 Gap: 33/201 gyZ8pzu3InY1sqSUR7GRePGgQ7o 11991166 176 E: 2E0 Ident: 19/102 Ident% 18 Q: 61-154 (157)   S: 63-164 (176) streptothricin acetyltransferase [Staphylococcus intermedius] Pos: 39/102 Gap: 8/102 SMbCXvUndKcQ47Ve5di2JmQqTPM 15889043 17935633 15156838 17740179 151 E: .005E0 Ident: 19/106 Ident% 17 Q: 61-153 (157)   S: 43-148 (151) acetyltransferase [Agrobacterium tumefaciens str. C58 (U. Washington)] acetyltransferase [Agrobacterium tumefaciens str. C58 (U. Washington)] Pos: 41/106 Gap: 13/106 rpIZtc9fr3lSLWXJL7s9Z91OpCw 15224925 3786005 421 E: 1.5E0 Ident: 11/55 Ident% 20 Q: 181-228 (157)   S: 61-115 (421) putative phospholipid cytidylyltransferase [Arabidopsis thaliana] putative phospholipid cytidylyltransferase [Arabidopsis thaliana] Pos: 21/55 Gap: 7/55 69GiKLeNrUTYr4J5rr+CbUzgwUM 18313219 18160736 168 E: .018E0 Ident: 9/56 Ident% 16 Q: 177-227 (157)   S: 3-58 (168) conserved protein (possible cytidylyltransferase) [Pyrobaculum aerophilum] conserved protein (possible cytidylyltransferase) [Pyrobaculum aerophilum] Pos: 20/56 Gap: 5/56 oaBKf2JF/SACORGtDx7/+B1h9go 123976 94615 580700 153 E: .15E0 Ident: 18/81 Ident% 22 Q: 68-139 (157)   S: 51-131 (153) IAA ACETYLTRANSFERASE acetyl transferase - Azospirillum brasilense acetyl transferase [Azospirillum brasilense] Pos: 34/81 Gap: 9/81 7p2SifP/2v4DlvFO9qUcqZxI9Ys 9716883 160 E: 3.6E0 Ident: 17/100 Ident% 17 Q: 66-150 (157)   S: 23-121 (160) dJ1002M8.1 (N-terminal acetyltransferase complex ard1 subunit) [Homo sapiens] Pos: 38/100 Gap: 16/100 BKFUQI3aTk3yfbOf+1cE8PzNEc8 11499896 10720124 7450067 2648204 174 E: .39E0 Ident: 11/62 Ident% 17 Q: 177-233 (157)   S: 3-64 (174) Nicotinamide-nucleotide adenylyltransferase (NAD(+) pyrophosphorylase) (NAD(+) diphosphorylase) (NMN adenylyltransferase) Pos: 25/62 Gap: 5/62 Z/p8cnXLxxvWXiV8nDL9sIKHsE8 17549056 17431307 345 E: .022E0 Ident: 10/58 Ident% 17 Q: 178-230 (157)   S: 12-69 (345) PUTATIVE BIFUNCTIONAL NMN ADENYLYLTRANSFERASE/NUDIX HYDROLASE : NICOTINAMIDE-NUCLEOTIDE ADENYLYLTRANSFERASE AND ADP COMPOUNDS HYDROLASE PROTEIN [Ralstonia solanacearum] PUTATIVE BIFUNCTIONAL NMN ADENYLYLTRANSFERASE/NUDIX HYDROLASE : NICOTINAMIDE-NUCLEOTIDE ADENYLYLTRANSFERASE AND ADP COMPOUNDS HYDROLASE PROTEIN [Ralstonia solanacearum] PUTATIVE BIFUNCTIONAL NMN ADENYLYLTRANSFERASE/NUDIX HYDROLASE : NICOTINAMIDE-NUCLEOTIDE ADENYLYLTRANSFERASE AND ADP COMPOUNDS HYDROLASE PROTEIN [Ralstonia solanacearum] PUTATIVE BIFUNCTIONAL NMN ADENYLYLTRANSFERASE/NUDIX HYDROLASE : NICOTINAMIDE-NUCLEOTIDE ADENYLYLTRANSFERASE AND ADP COMPOUNDS HYDROLASE PROTEIN [Ralstonia solanacearum] Pos: 24/58 Gap: 5/58 vjnHp05heYmORNu3qEXdveitBjI 15640675 11355828 9655092 183 E: .76E0 Ident: 20/118 Ident% 16 Q: 50-144 (157)   S: 30-143 (183) acetyltransferase, putative [Vibrio cholerae] probable acetyltransferase VC0655 [imported] - Vibrio cholerae (group O1 strain N16961) acetyltransferase, putative [Vibrio cholerae] Pos: 41/118 Gap: 27/118 +XlI2jxnXLmRTOrrqVjwiOSsVec 15617045 14194957 10039110 214 E: 3.9E0 Ident: 8/59 Ident% 13 Q: 177-229 (157)   S: 6-64 (214) Probable nicotinate-nucleotide adenylyltransferase (Deamido-NAD(+) pyrophosphorylase) (Deamido-NAD(+) diphosphorylase) (Nicotinate mononucleotide adenylyltransferase) (NAMN adenylyltransferase) Pos: 20/59 Gap: 6/59 eO3ExtMzICgJkiB2fpUEeqJThcE 16331894 10720128 7446147 1001812 339 E: .89E0 Ident: 8/67 Ident% 11 Q: 177-236 (157)   S: 8-74 (339) Bifunctional NMN adenylyltransferase/NUDIX hydrolase [Contains: Nicotinamide-nucleotide adenylyltransferase (NAD(+) pyrophosphorylase) (NAD(+) diphosphorylase) (NMN adenylyltransferase); ADP compounds hydrolase ] Bifunctional NMN adenylyltransferase/NUDIX hydrolase [Contains: Nicotinamide-nucleotide adenylyltransferase (NAD(+) pyrophosphorylase) (NAD(+) diphosphorylase) (NMN adenylyltransferase); ADP compounds hydrolase ] Pos: 25/67 Gap: 7/67 BxTF43/CSlp5hTSY4oA8aACEvmM 134953 80814 153476 189 E: .43E0 Ident: 17/69 Ident% 24 Q: 62-124 (157)   S: 75-143 (189) STREPTOTHRICIN ACETYLTRANSFERASE (STAT) streptothricin acetyltransferase (EC 2.4.-.-) - Streptomyces lavendulae streptothricin acetyltransferase [Streptomyces lavendulae] Pos: 29/69 Gap: 6/69 XTR3z0kj/GzyFLMMqOhK2hzM6RE 15605755 7451666 2982903 157 E: 9.9E0 Ident: 8/41 Ident% 19 Q: 173-213 (157)   S: 18-58 (157) glycerol-3-phosphate cytidyltransferase [Aquifex aeolicus] glycerol-3-phosphate cytidyltransferase - Aquifex aeolicus glycerol-3-phosphate cytidyltransferase [Aquifex aeolicus] Pos: 16/41 Gap: -1/-1 KoV9qvd6L80su3ITj+R5Bbu04Dg 13096704 13096705 13096706 13096707 13096708 13096709 168 E: .004E0 Ident: 13/62 Ident% 20 Q: 177-233 (157)   S: 3-64 (168) Chain A, Crystal Structure Analysis Of Nmn Adenylyltransferase From Methanococcus Jannaschii Chain B, Crystal Structure Analysis Of Nmn Adenylyltransferase From Methanococcus Jannaschii Chain C, Crystal Structure Analysis Of Nmn Adenylyltransferase From Methanococcus Jannaschii Chain D, Crystal Structure Analysis Of Nmn Adenylyltransferase From Methanococcus Jannaschii Chain E, Crystal Structure Analysis Of Nmn Adenylyltransferase From Methanococcus Jannaschii Chain F, Crystal Structure Analysis Of Nmn Adenylyltransferase From Methanococcus Jannaschii Pos: 26/62 Gap: 5/62 7V22d+mGp8n4UGzqGqnPHJI/5cQ 15613110 10173160 151 E: 6.6E0 Ident: 17/78 Ident% 21 Q: 69-139 (157)   S: 49-126 (151) ribosomal-protein (S18)-alanine acetyltransferase [Bacillus halodurans] ribosomal-protein (S18)-alanine acetyltransferase [Bacillus halodurans] Pos: 30/78 Gap: 7/78 akV10Kwzqf5+NJJZqRxRYGoN964 732998 1089990 180 E: 2.3E0 Ident: 19/102 Ident% 18 Q: 61-154 (157)   S: 67-168 (180) streptothricine-acetyl-transferase [Campylobacter coli] streptothricin acetyltransferase [Campylobacter coli] Pos: 39/102 Gap: 8/102 5TqNyvE/GwKSQK8mq5XHunXK4L8 15793421 10720110 11278844 7379166 197 E: .098E0 Ident: 18/67 Ident% 26 Q: 174-230 (157)   S: 2-64 (197) Probable nicotinate-nucleotide adenylyltransferase (Deamido-NAD(+) pyrophosphorylase) (Deamido-NAD(+) diphosphorylase) (Nicotinate mononucleotide adenylyltransferase) (NAMN adenylyltransferase) Pos: 27/67 Gap: 14/67 4yRU9B8n0E6hoDcm/42UmItP+hc 16799490 16412842 141 E: 9.1E0 Ident: 13/59 Ident% 22 Q: 91-145 (157)   S: 69-124 (141) weakly similar to blasticidin S-acetyltransferase [Listeria innocua] weakly similar to blasticidin S-acetyltransferase [Listeria innocua] Pos: 28/59 Gap: 7/59 MqltebmSiOwzVjDVsFH3nmeUXFk 18311148 18145831 148 E: .73E0 Ident: 12/54 Ident% 22 Q: 91-141 (157)   S: 72-125 (148) ribosomal-protein-alanine N-acetyltransferase [Clostridium perfringens] ribosomal-protein-alanine N-acetyltransferase [Clostridium perfringens] Pos: 23/54 Gap: 3/54 AhuBb3M19a9m3mXfQbnEdnu/7VM 15669368 2128710 1591806 149 E: 4.6E0 Ident: 10/61 Ident% 16 Q: 174-226 (157)   S: 2-62 (149) glycerol-3-phosphate cytidyltransferase (taqD) [Methanococcus jannaschii] glycerol-3-phosphate cytidyltransferase (taqD) [Methanococcus jannaschii] Pos: 22/61 Gap: 8/61 WwH/m6ylg3zYxVX2XKWLV1C423Q 14590218 7451125 3256685 172 E: .001E0 Ident: 16/100 Ident% 16 Q: 61-150 (157)   S: 54-151 (172) acetyltransferase [Pyrococcus horikoshii] probable acetyltransferase - Pyrococcus horikoshii 172aa long hypothetical acetyltransferase [Pyrococcus horikoshii] Pos: 41/100 Gap: 12/100 Dez/B5lspDirES8D83mFUFrR/Ck 15793266 11282822 7379010 163 E: .57E0 Ident: 15/81 Ident% 18 Q: 68-138 (157)   S: 60-139 (163) putative acetyltransferase [Neisseria meningitidis Z2491] probable acetyltransferase NMA0248 [imported] - Neisseria meningitidis (group A strain Z2491) putative acetyltransferase [Neisseria meningitidis Z2491] Pos: 27/81 Gap: 11/81 ERcL0f67MAzOs3oOD75Mwvd0IMA 17936141 17740732 137 E: 2.5E0 Ident: 19/89 Ident% 21 Q: 69-150 (157)   S: 39-126 (137) acetyltransferase [Agrobacterium tumefaciens str. C58 (U. Washington)] acetyltransferase [Agrobacterium tumefaciens str. C58 (U. Washington)] Pos: 40/89 Gap: 8/89 rbeGwLjG0LPnfq3ccAm1D7gpZPw 12963555 9367114 12835769 18043304 276 E: 5.7E0 Ident: 12/52 Ident% 23 Q: 161-210 (157)   S: 157-207 (276) RIKEN cDNA 1190017B19 [Mus musculus] RIKEN cDNA 1190017B19 gene [Mus musculus] Pos: 23/52 Gap: 3/52 Qk6yDRJEbILTqFobOHN0ue6/jLA 15605718 7444639 2982868 314 E: .83E0 Ident: 35/197 Ident% 17 Q: 164-354 (157)   S: 16-195 (314) riboflavin kinase [Aquifex aeolicus] riboflavin kinase - Aquifex aeolicus riboflavin kinase [Aquifex aeolicus] Pos: 66/197 Gap: 23/197 qBEzcVtBnDy8x5ofG+kXzvrha2I 15827107 2496470 2145973 467109 13092655 359 E: .1E0 Ident: 16/53 Ident% 30 Q: 91-142 (157)   S: 286-337 (359) putative acetyltransferase [Mycobacterium leprae] ribosomal-protein-alanine N-acetyltransferase (EC 2.3.1.128) (cosmid B229) - Mycobacterium leprae rim; 30S Ribosomal protein S18 alanine acetyltransferase; B229_C1_170 [Mycobacterium leprae] putative acetyltransferase [Mycobacterium leprae] Pos: 25/53 Gap: 2/53 M4s1B+SORNY7gDhgfgSR1WmFzC8 15675949 11282821 7225226 163 E: .85E0 Ident: 11/48 Ident% 22 Q: 91-138 (157)   S: 93-139 (163) acetyltransferase, putative [Neisseria meningitidis MC58] acetyltransferase, probable NMB0001 [imported] - Neisseria meningitidis (group B strain MD58) acetyltransferase, putative [Neisseria meningitidis MC58] Pos: 19/48 Gap: 1/48 /LieLp8UHvEAHkifvw887C658mw 12957030 14456346 180 E: 2.1E0 Ident: 19/102 Ident% 18 Q: 61-154 (157)   S: 67-168 (180) streptothricin acetyltransferase [Enterococcus faecalis] streptothricin acetyltransferase [Enterococcus faecium] Pos: 39/102 Gap: 8/102 8sYLBw9cYyIlDgsckKzTW5+zrk0 16079618 1730983 7430069 1303791 2635010 189 E: 3.1E0 Ident: 7/18 Ident% 38 Q: 174-191 (157)   S: 2-19 (189) Probable nicotinate-nucleotide adenylyltransferase (Deamido-NAD(+) pyrophosphorylase) (Deamido-NAD(+) diphosphorylase) (Nicotinate mononucleotide adenylyltransferase) (NAMN adenylyltransferase) Pos: 8/18 Gap: -1/-1 Rr5jRjIJsQfSn0Ia4dWK/n0zLCs 15599873 11350733 9950934 150 E: 4.6E0 Ident: 12/62 Ident% 19 Q: 91-149 (157)   S: 71-132 (150) peptide n-acetyltransferase RimI [Pseudomonas aeruginosa] peptide n-acetyltransferase RimI PA4678 [imported] - Pseudomonas aeruginosa (strain PAO1) peptide n-acetyltransferase RimI [Pseudomonas aeruginosa] Pos: 24/62 Gap: 3/62 LWNTjZikm6sarAer6T2kNUZ2gRY 1351699 7492353 1107891 150 E: 7.3E0 Ident: 12/52 Ident% 23 Q: 91-140 (157)   S: 79-130 (150) probable acetyltransferase - fission yeast (Schizosaccharomyces pombe) elaa family protein; putative acetyl transferase [Schizosaccharomyces pombe] Pos: 21/52 Gap: 2/52 10GmndfdP1abJ6KxTATvJ4GL36o 17229975 17131575 200 E: .023E0 Ident: 15/61 Ident% 24 Q: 174-232 (157)   S: 2-62 (200) nicotinate-nucleotide adenylyltransferase [Nostoc sp. PCC 7120] nicotinate-nucleotide adenylyltransferase [Nostoc sp. PCC 7120] Pos: 29/61 Gap: 2/61 sQV/FFlmQ4eFfsWBSbC3oSc9bmY 15601231 11355835 6175885 9657873 144 E: .17E0 Ident: 16/107 Ident% 14 Q: 39-141 (157)   S: 25-127 (144) acetyltransferase, putative [Vibrio cholerae] probable acetyltransferase VCA0470 [imported] - Vibrio cholerae (group O1 strain N16961) acetyltransferase, putative [Vibrio cholerae] Pos: 36/107 Gap: 8/107 lXngE/BCHU+BEe9xAZA1/24RDVw 17230428 17132030 534 E: 5.2E0 Ident: 7/37 Ident% 18 Q: 176-212 (157)   S: 42-77 (534) pantothenate synthetase [Nostoc sp. PCC 7120] pantothenate synthetase [Nostoc sp. PCC 7120] Pos: 14/37 Gap: 1/37 cWv7tRckukkcSn7mKD3ZCS73bpY 16271985 1172933 1572953 146 E: 1.3E0 Ident: 14/83 Ident% 16 Q: 73-149 (157)   S: 47-129 (146) ribosomal-protein-alanine acetyltransferase (rimI) [Haemophilus influenzae Rd] Ribosomal-protein-alanine acetyltransferase (Acetylating enzyme for N-terminal of ribosomal protein S18) ribosomal-protein-alanine acetyltransferase (rimI) [Haemophilus influenzae Rd] Pos: 31/83 Gap: 6/83 ykogaGD5bpX/6EAmFyxCYdwNBME 16123551 15981329 284 E: 5.7E0 Ident: 8/50 Ident% 16 Q: 163-212 (157)   S: 11-59 (284) pantoate--beta-alanine ligase [Yersinia pestis] pantoate--beta-alanine ligase [Yersinia pestis] Pos: 21/50 Gap: 1/50 +Vc10LqAJ+63h5pr5P/DDIqtgRU 12643468 282 E: 2.3E0 Ident: 11/55 Ident% 20 Q: 158-212 (157)   S: 9-58 (282) PANTOATE--BETA-ALANINE LIGASE (PANTOTHENATE SYNTHETASE) (PANTOATE ACTIVATING ENZYME) PANTOATE--BETA-ALANINE LIGASE (PANTOTHENATE SYNTHETASE) (PANTOATE ACTIVATING ENZYME) Pos: 21/55 Gap: 5/55 1651lRrZuAeGVDcpDEpLzgD5L/4 17737505 18485802 1669666 7291751 275 E: .64E0 Ident: 17/75 Ident% 22 Q: 71-144 (157)   S: 168-235 (275) Dopamine N acetyltransferase; Arylalkylamine N-acetyltransferase-1 [Drosophila melanogaster] Dopamine N acetyltransferase [Drosophila melanogaster] N-acetyltransferase [Drosophila melanogaster] Pos: 28/75 Gap: 8/75 9VuLV8UQXQm5clTVQo8OPq+uDak 10720131 172 E: .67E0 Ident: 10/65 Ident% 15 Q: 175-233 (157)   S: 2-65 (172) Nicotinamide-nucleotide adenylyltransferase (NAD(+) pyrophosphorylase) (NAD(+) diphosphorylase) (NMN adenylyltransferase) Pos: 24/65 Gap: 7/65 9eBCQzuvOtM7VjoN37sJ8p8oc8k 13470923 14021666 156 E: .17E0 Ident: 13/63 Ident% 20 Q: 88-147 (157)   S: 73-135 (156) probable acetyltransferase [Mesorhizobium loti] probable acetyltransferase [Mesorhizobium loti] Pos: 23/63 Gap: 3/63 immsQ3Rhg2Ox0d0Q9A7xn83VHA0 15614531 10174586 153 E: .78E0 Ident: 18/87 Ident% 20 Q: 69-140 (157)   S: 58-143 (153) transcriptional regulator [Bacillus halodurans] transcriptional regulator [Bacillus halodurans] transcriptional regulator [Bacillus halodurans] transcriptional regulator [Bacillus halodurans] Pos: 29/87 Gap: 16/87 Aq2FkvDKhCuKKhNtAV6WphTwzgg 17986493 17982094 224 E: .67E0 Ident: 18/72 Ident% 25 Q: 173-237 (157)   S: 30-100 (224) NICOTINATE-NUCLEOTIDE ADENYLYLTRANSFERASE / NICOTINAMIDE-NUCLEOTIDE ADENYLYLTRANSFERASE [Brucella melitensis] NICOTINATE-NUCLEOTIDE ADENYLYLTRANSFERASE / NICOTINAMIDE-NUCLEOTIDE ADENYLYLTRANSFERASE [Brucella melitensis] Pos: 29/72 Gap: 8/72 j0ro5wiCqBFeU4N/+spGjwbPna8 18312638 18160111 178 E: 7E-4 Ident: 32/213 Ident% 15 Q: 175-375 (157)   S: 2-169 (178) cytidylyltransferase [Pyrobaculum aerophilum] cytidylyltransferase [Pyrobaculum aerophilum] Pos: 69/213 Gap: 57/213 cNU3Y7jGlpWsb4iSzjOXIvpguSQ 16764022 16419157 213 E: 2E-4 Ident: 40/216 Ident% 18 Q: 177-364 (157)   S: 6-208 (213) putative Nicotinic acid mononucleotide adenylyltransferase [Salmonella typhimurium LT2] putative Nicotinic acid mononucleotide adenylyltransferase [Salmonella typhimurium LT2] Pos: 68/216 Gap: 41/216 y073+7CySd3tcDw0DnM0yE3uUrY 16761768 16504070 443 E: 1E-4 Ident: 22/123 Ident% 17 Q: 46-162 (157)   S: 315-431 (443) N-acetylglutamate synthase [Salmonella enterica subsp. enterica serovar Typhi] N-acetylglutamate synthase [Salmonella enterica subsp. enterica serovar Typhi] Pos: 46/123 Gap: 12/123 vwEefFfAfuQ17xVzXl2qKeg8AaY 15793571 11257257 7379316 436 E: 2E-4 Ident: 27/126 Ident% 21 Q: 46-165 (157)   S: 306-423 (436) putative acetylglutamate synthase [Neisseria meningitidis Z2491] probable amino-acid N-acetyltransferase (EC 2.3.1.1) NMA0580 [imported] - Neisseria meningitidis (group A strain Z2491) putative acetylglutamate synthase [Neisseria meningitidis Z2491] Pos: 44/126 Gap: 14/126 QS+KrBce3jbDkAnV6O6nyOZB+ws 14521872 7445392 5459092 172 E: 3E-4 Ident: 17/101 Ident% 16 Q: 61-150 (157)   S: 54-151 (172) N-terminal acetyltransferase [Pyrococcus abyssi] n-terminal acetyltransferase PAB1098 - Pyrococcus abyssi (strain Orsay) N-terminal acetyltransferase [Pyrococcus abyssi] Pos: 42/101 Gap: 14/101 YzLxGK1yThdiL79Z4DTSW/sREB0 10720129 173 E: 6E-4 Ident: 12/62 Ident% 19 Q: 175-231 (157)   S: 2-63 (173) Nicotinamide-nucleotide adenylyltransferase (NAD(+) pyrophosphorylase) (NAD(+) diphosphorylase) (NMN adenylyltransferase) Pos: 23/62 Gap: 5/62 M86u/CORveuSwjG3jasG7mAHHs8 3128253 443 E: 3E-4 Ident: 23/123 Ident% 18 Q: 46-162 (157)   S: 315-431 (443) N-acetylglutamate synthetase [Escherichia coli] Pos: 46/123 Gap: 12/123 okrmLdkYbZH6yXLRu/ZQGZBYSTg 14423765 172 E: 2E-4 Ident: 12/60 Ident% 20 Q: 177-231 (157)   S: 4-63 (172) Nicotinamide-nucleotide adenylyltransferase (NAD(+) pyrophosphorylase) (NAD(+) diphosphorylase) (NMN adenylyltransferase) Pos: 23/60 Gap: 5/60 zOruFMn+5fqjumPEEmRBzrnOduU 3128255 443 E: 1E-4 Ident: 23/125 Ident% 18 Q: 46-164 (157)   S: 315-433 (443) N-acetylglutamate synthetase [Escherichia coli] Pos: 46/125 Gap: 12/125 Ovu2veV3LuRWg2u/98llNIkOlSc 3128249 443 E: 3E-4 Ident: 23/123 Ident% 18 Q: 46-162 (157)   S: 315-431 (443) N-acetylglutamate synthetase [Escherichia coli] Pos: 46/123 Gap: 12/123 dApbJ0BQybTJ5HNq0gEBJ3aQF1Q 16766294 16421541 443 E: 1E-4 Ident: 22/123 Ident% 17 Q: 46-162 (157)   S: 315-431 (443) N-alpha-acetylglutamate synthase (amino-acid acetyltransferase) [Salmonella typhimurium LT2] N-alpha-acetylglutamate synthase (amino-acid acetyltransferase) [Salmonella typhimurium LT2] N-alpha-acetylglutamate synthase (amino-acid acetyltransferase) [Salmonella typhimurium LT2] N-alpha-acetylglutamate synthase (amino-acid acetyltransferase) [Salmonella typhimurium LT2] Pos: 46/123 Gap: 12/123 X+FRIwv2e9zJhVAK1hEQL3rNkJg 8671273 629 E: 2E-4 Ident: 17/98 Ident% 17 Q: 48-139 (157)   S: 485-579 (629) argininosuccinase and n-acetylglutamate synthase [Moritella sp. 2693] Pos: 35/98 Gap: 9/98 43D07cXbTbl3dSCDBVPJvNrZHWc 3128247 443 E: 3E-4 Ident: 23/123 Ident% 18 Q: 46-162 (157)   S: 315-431 (443) N-acetylglutamate synthetase [Escherichia coli] Pos: 46/123 Gap: 12/123 UM6uYG3MjtZWOC2cSJ0i2TtEHJI 15803337 15832929 16130722 114135 66497 581038 882710 1789181 12517300 13363147 443 E: 3E-4 Ident: 23/123 Ident% 18 Q: 46-162 (157)   S: 315-431 (443) N-acetylglutamate synthase; amino acid acetyltransferase [Escherichia coli O157:H7 EDL933] N-acetylglutamate synthase; amino acid acetyltransferase [Escherichia coli O157:H7 EDL933] N-acetylglutamate synthase [Escherichia coli O157:H7] N-acetylglutamate synthase; amino acid acetyltransferase [Escherichia coli K12] N-acetylglutamate synthase; amino acid acetyltransferase [Escherichia coli K12] AMINO-ACID ACETYLTRANSFERASE (N-ACETYLGLUTAMATE SYNTHASE) (AGS) (NAGS) AMINO-ACID ACETYLTRANSFERASE (N-ACETYLGLUTAMATE SYNTHASE) (AGS) (NAGS) amino-acid N-acetyltransferase (EC 2.3.1.1) - Escherichia coli N-acetylglutamate synthase (AA 1 - 443) [Escherichia coli] N-acetylglutamate synthase [Escherichia coli] N-acetylglutamate synthase; amino acid acetyltransferase [Escherichia coli K12] N-acetylglutamate synthase; amino acid acetyltransferase [Escherichia coli K12] N-acetylglutamate synthase; amino acid acetyltransferase [Escherichia coli O157:H7 EDL933] N-acetylglutamate synthase; amino acid acetyltransferase [Escherichia coli O157:H7 EDL933] N-acetylglutamate synthase [Escherichia coli O157:H7] Pos: 46/123 Gap: 12/123 4BM88bk0bMXHWB0vlrRoHp6sY0g 16122820 15980594 220 E: 6E-4 Ident: 42/224 Ident% 18 Q: 177-363 (157)   S: 12-213 (220) putative nicotinate-nucleotide adenylyltransferase [Yersinia pestis] putative nicotinate-nucleotide adenylyltransferase [Yersinia pestis] Pos: 72/224 Gap: 59/224 FnKCGb9hEQHS5Vv7facCJxXG4jw 3128251 443 E: 3E-4 Ident: 23/123 Ident% 18 Q: 46-162 (157)   S: 315-431 (443) N-acetylglutamate synthetase [Escherichia coli] Pos: 46/123 Gap: 12/123 mls9HFMVCxVPX6yUqzq+bvZwggc 15227764 3445208 620 E: 3E-4 Ident: 25/107 Ident% 23 Q: 41-141 (157)   S: 471-576 (620) putative amino acid acetyltransferase [Arabidopsis thaliana] putative amino acid acetyltransferase [Arabidopsis thaliana] Pos: 41/107 Gap: 7/107 OTk8KiU3VD9GqgvpP6ahLFJFanc 15677711 11257259 7227134 436 E: 2E-4 Ident: 27/126 Ident% 21 Q: 46-165 (157)   S: 306-423 (436) N-acetylglutamate synthase [Neisseria meningitidis MC58] N-acetylglutamate synthase NMB1876 [imported] - Neisseria meningitidis (group B strain MD58) N-acetylglutamate synthase [Neisseria meningitidis MC58] Pos: 44/126 Gap: 14/126 BQXiY7DhE8GI6MwoqSK5nA7nOHE 11280185 5931750 175 E: 5E-4 Ident: 12/62 Ident% 19 Q: 175-231 (157)   S: 4-65 (175) probable F420H2-dehydrogenase [imported] - Methanolobus tindarius probable F420H2-dehydrogenase [imported] - Methanolobus tindarius F420H2-dehydrogenase subunit, putative [Methanolobus tindarius] F420H2-dehydrogenase subunit, putative [Methanolobus tindarius] Pos: 23/62 Gap: 5/62 K4j2JCicbDVio3AkWxsOq0ozCDo 18892210 170 E: 2E-4 Ident: 15/100 Ident% 15 Q: 61-150 (157)   S: 52-149 (170) ribosomal protein s18 alanine acetyltransferase [Pyrococcus furiosus DSM 3638] Pos: 39/100 Gap: 12/100 JSwRRpGFKqvl5BGHK7xvM/eIqaA 15599201 14194964 11350063 9950198 214 E: 7E-4 Ident: 42/213 Ident% 19 Q: 173-365 (157)   S: 2-207 (214) Probable nicotinate-nucleotide adenylyltransferase (Deamido-NAD(+) pyrophosphorylase) (Deamido-NAD(+) diphosphorylase) (Nicotinate mononucleotide adenylyltransferase) (NAMN adenylyltransferase) Pos: 66/213 Gap: 27/213 aYeDbrsfn5Ti0/BjIDuKUCsmF98 17232555 17134201 208 E: 5E-5 Ident: 41/218 Ident% 18 Q: 174-365 (157)   S: 2-200 (208) nicotinate-nucleotide adenylyltransferase [Nostoc sp. PCC 7120] nicotinate-nucleotide adenylyltransferase [Nostoc sp. PCC 7120] Pos: 69/218 Gap: 45/218 6Ybw2gUj+NEqrIxI48IBkCscD9s 15673969 12725032 379 E: 2E-5 Ident: 18/79 Ident% 22 Q: 164-237 (157)   S: 4-82 (379) transcriptional regulator [Lactococcus lactis subsp. lactis] transcriptional regulator [Lactococcus lactis subsp. lactis] transcriptional regulator [Lactococcus lactis subsp. lactis] transcriptional regulator [Lactococcus lactis subsp. lactis] Pos: 30/79 Gap: 5/79 Kc9Qf9HwiS4dDQmfnVJmN5QZnEU 7480402 4585608 169 E: 2E-5 Ident: 18/104 Ident% 17 Q: 52-146 (157)   S: 30-129 (169) probable acetyltransferase - Streptomyces coelicolor putative acetyltransferase [Streptomyces coelicolor A3(2)] Pos: 45/104 Gap: 13/104 hh541r+9l3tA+MMmlzDhimT56p0 15842287 13882581 164 E: 5E-5 Ident: 21/106 Ident% 19 Q: 51-146 (157)   S: 23-124 (164) acetyltransferase, GNAT family [Mycobacterium tuberculosis CDC1551] acetyltransferase, GNAT family [Mycobacterium tuberculosis CDC1551] Pos: 44/106 Gap: 14/106 rfUckdVyPRzEkKV74Fb390hNGAY 16121323 15979090 441 E: 7E-6 Ident: 21/102 Ident% 20 Q: 46-141 (157)   S: 314-414 (441) amino-acid acetyltransferase [Yersinia pestis] amino-acid acetyltransferase [Yersinia pestis] Pos: 40/102 Gap: 7/102 ZCtM9ZLckoMV4w9lXJn9aBFyZJU 15600397 12644651 11350625 9951510 432 E: 3E-6 Ident: 28/130 Ident% 21 Q: 46-166 (157)   S: 305-432 (432) N-acetylglutamate synthase [Pseudomonas aeruginosa] Amino-acid acetyltransferase (N-acetylglutamate synthase) (AGS) (NAGS) Amino-acid acetyltransferase (N-acetylglutamate synthase) (AGS) (NAGS) N-acetylglutamate synthase PA5204 [imported] - Pseudomonas aeruginosa (strain PAO1) N-acetylglutamate synthase [Pseudomonas aeruginosa] Pos: 50/130 Gap: 11/130 hFjBQJ4xQF/GdpOL6lKK2rovwxA 15642314 11257255 9656881 456 E: 2E-6 Ident: 22/104 Ident% 21 Q: 46-143 (157)   S: 329-431 (456) N-acetylglutamate synthase [Vibrio cholerae] N-acetylglutamate synthase VC2316 [imported] - Vibrio cholerae (group O1 strain N16961) N-acetylglutamate synthase [Vibrio cholerae] Pos: 39/104 Gap: 7/104 zxxr7E3tRShRlSAfmWIyaYscJIQ 15827464 2052104 13093014 180 E: 1E-6 Ident: 24/106 Ident% 22 Q: 51-146 (157)   S: 39-140 (180) putative acetyltransferase [Mycobacterium leprae] putative acetyltransferase [Mycobacterium leprae] Pos: 45/106 Gap: 14/106 HFJsoWsuCdmG95rIqQbaW8U5iDw 16272704 1171638 1075061 1573771 421 E: 2E-7 Ident: 23/112 Ident% 20 Q: 135-234 (157)   S: 22-130 (421) transcriptional regulator (nadR) [Haemophilus influenzae Rd] transcriptional regulator (nadR) [Haemophilus influenzae Rd] Transcriptional regulator NADR Transcriptional regulator NADR transcription regulator nadR - Haemophilus influenzae (strain Rd KW20) transcription regulator nadR - Haemophilus influenzae (strain Rd KW20) transcriptional regulator (nadR) [Haemophilus influenzae Rd] transcriptional regulator (nadR) [Haemophilus influenzae Rd] Pos: 39/112 Gap: 15/112 XPm+L2sqANfjDaRgL+coUwjD6QM 15828568 14089510 149 E: 3E-10 Ident: 20/111 Ident% 18 Q: 174-277 (157)   S: 5-115 (149) LIPOPOLYSACCHARIDE CORE BIOSYNTHESIS PROTEIN KDTB HOMOLOG [Mycoplasma pulmonis] LIPOPOLYSACCHARIDE CORE BIOSYNTHESIS PROTEIN KDTB HOMOLOG [Mycoplasma pulmonis] Pos: 44/111 Gap: 7/111 kMjEGWSJnz5KjX3UD0SEZ96Nt/g 16767821 16423146 410 E: 4E-11 Ident: 22/81 Ident% 27 Q: 174-242 (157)   S: 64-144 (410) three acitivities: regulator of nadAB transcription, regulator of PnuC activity, also contains NMN adenylyltransferase activity [Salmonella typhimurium LT2] three acitivities: regulator of nadAB transcription, regulator of PnuC activity, also contains NMN adenylyltransferase activity [Salmonella typhimurium LT2] three acitivities: regulator of nadAB transcription, regulator of PnuC activity, also contains NMN adenylyltransferase activity [Salmonella typhimurium LT2] three acitivities: regulator of nadAB transcription, regulator of PnuC activity, also contains NMN adenylyltransferase activity [Salmonella typhimurium LT2] three acitivities: regulator of nadAB transcription, regulator of PnuC activity, also contains NMN adenylyltransferase activity [Salmonella typhimurium LT2] three acitivities: regulator of nadAB transcription, regulator of PnuC activity, also contains NMN adenylyltransferase activity [Salmonella typhimurium LT2] Pos: 33/81 Gap: 12/81 iis7nLNAS9tPubcweGXb916b/kg 730107 410 E: 4E-11 Ident: 23/86 Ident% 26 Q: 169-242 (157)   S: 59-144 (410) TRANSCRIPTIONAL REGULATOR NADR TRANSCRIPTIONAL REGULATOR NADR Pos: 35/86 Gap: 12/86 OG0kxSxtsNyyU1acO2XwtbtMNds 127799 96810 643057 409 E: 4E-11 Ident: 22/81 Ident% 27 Q: 174-242 (157)   S: 63-143 (409) TRANSCRIPTIONAL REGULATOR NADR TRANSCRIPTIONAL REGULATOR NADR Pos: 33/81 Gap: 12/81 FEqIont7aI4DO7SFLywi3f33YCk 16132207 1361217 537230 1790851 417 E: 4E-11 Ident: 23/86 Ident% 26 Q: 169-242 (157)   S: 66-151 (417) probable nadAB transcriptional regulator [Escherichia coli K12] probable nadAB transcriptional regulator [Escherichia coli K12] transcription regulator nadR - Escherichia coli transcription regulator nadR - Escherichia coli probable nadAB transcriptional regulator [Escherichia coli K12] probable nadAB transcriptional regulator [Escherichia coli K12] Pos: 35/86 Gap: 12/86 21VHqhpboOg22IjAPjYPB1DE3Jo 16763371 16505680 410 E: 4E-11 Ident: 22/81 Ident% 27 Q: 174-242 (157)   S: 64-144 (410) conserved hypothetical transcriptional regulator [Salmonella enterica subsp. enterica serovar Typhi] conserved hypothetical transcriptional regulator [Salmonella enterica subsp. enterica serovar Typhi] conserved hypothetical transcriptional regulator [Salmonella enterica subsp. enterica serovar Typhi] conserved hypothetical transcriptional regulator [Salmonella enterica subsp. enterica serovar Typhi] Pos: 33/81 Gap: 12/81 ziG028+FZdlIBc2QgDPipVnKlTc 15804961 15834602 12519419 13364826 417 E: 4E-11 Ident: 23/86 Ident% 26 Q: 169-242 (157)   S: 66-151 (417) probable nadAB transcriptional regulator [Escherichia coli O157:H7 EDL933] probable nadAB transcriptional regulator [Escherichia coli O157:H7 EDL933] probable nadAB transcriptional regulator [Escherichia coli O157:H7] probable nadAB transcriptional regulator [Escherichia coli O157:H7] probable nadAB transcriptional regulator [Escherichia coli O157:H7 EDL933] probable nadAB transcriptional regulator [Escherichia coli O157:H7 EDL933] probable nadAB transcriptional regulator [Escherichia coli O157:H7] probable nadAB transcriptional regulator [Escherichia coli O157:H7] Pos: 35/86 Gap: 12/86 2GOptagvF4Obnt1Y3Lkj/wZr10c 1170641 602685 140 E: 8E-12 Ident: 17/99 Ident% 17 Q: 175-268 (157)   S: 2-100 (140) Phosphopantetheine adenylyltransferase (Pantetheine-phosphate adenylyltransferase) (PPAT) (Dephospho-CoA pyrophosphorylase) Pos: 38/99 Gap: 5/99 T82auSgRhWJppC1kZbbuD9kPnSY 15639275 8469193 7448379 3322553 159 E: 1E-13 Ident: 22/121 Ident% 18 Q: 176-292 (157)   S: 2-120 (159) lipopolysaccharide core biosynthesis protein (kdtB) [Treponema pallidum] Phosphopantetheine adenylyltransferase (Pantetheine-phosphate adenylyltransferase) (PPAT) (Dephospho-CoA pyrophosphorylase) probable lipopolysaccharide core biosynthesis protein (kdtB) - syphilis spirochete lipopolysaccharide core biosynthesis protein (kdtB) [Treponema pallidum] Pos: 45/121 Gap: 6/121 S4ZpH5RzR1nDteq2L4IjQtKYiiU 16120775 15978538 423 E: 2E-13 Ident: 23/81 Ident% 28 Q: 174-242 (157)   S: 64-144 (423) transcriptional regulator NadR [Yersinia pestis] transcriptional regulator NadR [Yersinia pestis] transcriptional regulator NadR [Yersinia pestis] transcriptional regulator NadR [Yersinia pestis] Pos: 33/81 Gap: 12/81 A03X8+pxxj5shvaehbAMrE5YFCc 15965335 15074515 163 E: 1E-15 Ident: 17/114 Ident% 14 Q: 175-279 (157)   S: 2-115 (163) PROBABLE PHOSPHOPANTETHEINE ADENYLYLTRANSFERASE PROTEIN [Sinorhizobium meliloti] PROBABLE PHOSPHOPANTETHEINE ADENYLYLTRANSFERASE PROTEIN [Sinorhizobium meliloti] Pos: 40/114 Gap: 9/114 I/j4LF6SczWaxu0IvkXaA8dmTjk 15888987 17935575 15156771 17740115 164 E: 2E-16 Ident: 18/114 Ident% 15 Q: 175-279 (157)   S: 2-115 (164) phosphopantetheine adenylyltransferase [Agrobacterium tumefaciens str. C58 (U. Washington)] phosphopantetheine adenylyltransferase [Agrobacterium tumefaciens str. C58 (U. Washington)] Pos: 42/114 Gap: 9/114 bAS2NZIm2Ld2kLuXxSQFy05QZ54 13470907 14021650 166 E: 5E-16 Ident: 22/117 Ident% 18 Q: 175-282 (157)   S: 4-120 (166) phosphopantetheine adenylyltransferase [Mesorhizobium loti] phosphopantetheine adenylyltransferase [Mesorhizobium loti] Pos: 43/117 Gap: 9/117 QstFdUh3Cp7XDQ73XKn85qEpcb0 15677844 15793426 14194514 11279493 7227281 7379171 170 E: 4E-16 Ident: 19/110 Ident% 17 Q: 175-279 (157)   S: 7-116 (170) lipopolysaccharide core biosynthesis protein KdtB [Neisseria meningitidis MC58] putative lipopolysaccharide core biosynthesis protein [Neisseria meningitidis Z2491] Phosphopantetheine adenylyltransferase (Pantetheine-phosphate adenylyltransferase) (PPAT) (Dephospho-CoA pyrophosphorylase) lipopolysaccharide core biosynthesis protein KdtB NMB2019 [imported] - Neisseria meningitidis (group B strain MD58, group A strain Z2491) lipopolysaccharide core biosynthesis protein KdtB [Neisseria meningitidis MC58] putative lipopolysaccharide core biosynthesis protein [Neisseria meningitidis Z2491] Pos: 42/110 Gap: 5/110 Fj/Fzme01c85vAU7vAohOFagE2Y 17987169 17982836 164 E: 2E-17 Ident: 23/131 Ident% 17 Q: 175-296 (157)   S: 2-130 (164) PHOSPHOPANTETHEINE ADENYLYLTRANSFERASE [Brucella melitensis] PHOSPHOPANTETHEINE ADENYLYLTRANSFERASE [Brucella melitensis] Pos: 46/131 Gap: 11/131 tWvrBFYZ6Rbx/3SuFj3N8Hct5Ns 15595047 8469190 7448377 2688628 163 E: 4E-18 Ident: 20/109 Ident% 18 Q: 175-277 (157)   S: 2-110 (163) lipopolysaccharide biosynthesis-related protein (kdtB) [Borrelia burgdorferi] Phosphopantetheine adenylyltransferase (Pantetheine-phosphate adenylyltransferase) (PPAT) (Dephospho-CoA pyrophosphorylase) lipopolysaccharide biosynthesis-related protein (kdtB) homolog - Lyme disease spirochete lipopolysaccharide biosynthesis-related protein (kdtB) [Borrelia burgdorferi] Pos: 43/109 Gap: 6/109 VQBbjZ8uYrcp4eoGsBEhmhtFYnI 18920721 164 E: 4E-18 Ident: 21/117 Ident% 17 Q: 175-282 (157)   S: 2-118 (164) phosphopantetheine adenylyltransferase [Bartonella bacilliformis] Pos: 46/117 Gap: 9/117 drf7m8wiLqpkumsqGRiYZOM4fDw 15617173 11386687 10039238 165 E: 1E-20 Ident: 22/113 Ident% 19 Q: 174-281 (157)   S: 2-114 (165) lipopolysaccharide core biosynthesis protein kdtB [Buchnera sp. APS] Phosphopantetheine adenylyltransferase (Pantetheine-phosphate adenylyltransferase) (PPAT) (Dephospho-CoA pyrophosphorylase) lipopolysaccharide core biosynthesis protein kdtB [Buchnera sp. APS] Pos: 44/113 Gap: 5/113 BJs113pJfhDJLcawT3zqt42ylVU 8469198 6466228 178 E: 3E-20 Ident: 15/111 Ident% 13 Q: 176-277 (157)   S: 11-121 (178) Phosphopantetheine adenylyltransferase (Pantetheine-phosphate adenylyltransferase) (PPAT) (Dephospho-CoA pyrophosphorylase) lipopolysaccharide core biosynthesis protein [Zymomonas mobilis] Pos: 37/111 Gap: 9/111 9gBgRIVXdRHlcbgT25rAb7+pptQ 15674144 14194507 12725223 165 E: 2E-20 Ident: 41/195 Ident% 21 Q: 175-367 (157)   S: 4-163 (165) lipopolysaccharide core biosynthesis protein [Lactococcus lactis subsp. lactis] Phosphopantetheine adenylyltransferase (Pantetheine-phosphate adenylyltransferase) (PPAT) (Dephospho-CoA pyrophosphorylase) lipopolysaccharide core biosynthesis protein [Lactococcus lactis subsp. lactis] Pos: 74/195 Gap: 37/195 c4RMjlYOP5bwo2H4mGXiUFvEIao 16125828 14194502 13422972 163 E: 3E-20 Ident: 20/110 Ident% 18 Q: 175-277 (157)   S: 2-111 (163) lipopolysaccharide core biosynthesis protein KdtB [Caulobacter crescentus] Phosphopantetheine adenylyltransferase (Pantetheine-phosphate adenylyltransferase) (PPAT) (Dephospho-CoA pyrophosphorylase) lipopolysaccharide core biosynthesis protein KdtB [Caulobacter crescentus] Pos: 42/110 Gap: 7/110 bMRBpBCz08ZJ7DLQl26TFfXxe5U 8469203 4378709 165 E: 4E-21 Ident: 22/113 Ident% 19 Q: 174-281 (157)   S: 2-114 (165) Phosphopantetheine adenylyltransferase (Pantetheine-phosphate adenylyltransferase) (PPAT) (Dephospho-CoA pyrophosphorylase) putative lipopolysaccharide biosynthesis enzyme [Buchnera aphidicola] Pos: 40/113 Gap: 5/113 J8EileuTcXvHiu3cgmbXYXS/eVk 15837582 14194526 11279490 9105912 162 E: 1E-21 Ident: 17/110 Ident% 15 Q: 174-279 (157)   S: 6-115 (162) Phosphopantetheine adenylyltransferase (Pantetheine-phosphate adenylyltransferase) (PPAT) (Dephospho-CoA pyrophosphorylase) Pos: 38/110 Gap: 4/110 Q7RlO01cuQFEnd4zYN7PX6XTNGY 15792105 14194533 11279492 6968213 158 E: 2E-24 Ident: 31/189 Ident% 16 Q: 178-362 (157)   S: 4-152 (158) 3-deoxy-D-manno-octulosonic-acid transferase [Campylobacter jejuni] Phosphopantetheine adenylyltransferase (Pantetheine-phosphate adenylyltransferase) (PPAT) (Dephospho-CoA pyrophosphorylase) 3-deoxy-D-manno-octulosonic-acid transferase Cj0767c [imported] - Campylobacter jejuni (strain NCTC 11168) 3-deoxy-D-manno-octulosonic-acid transferase [Campylobacter jejuni] Pos: 62/189 Gap: 44/189 Ch5NyAvs28MOQtQYiIUKDx2HW2M 15646084 8469188 7448376 2314651 157 E: 3E-24 Ident: 18/108 Ident% 16 Q: 174-277 (157)   S: 2-109 (157) lipopolysaccharide core biosynthesis protein (kdtB) [Helicobacter pylori 26695] Phosphopantetheine adenylyltransferase (Pantetheine-phosphate adenylyltransferase) (PPAT) (Dephospho-CoA pyrophosphorylase) lipopolysaccharide core biosynthesis protein - Helicobacter pylori (strain 26695) lipopolysaccharide core biosynthesis protein (kdtB) [Helicobacter pylori 26695] Pos: 41/108 Gap: 4/108 1FOjCrq89HzJsXlmd3aNOLCIymo 9971914 195 E: 3E-24 Ident: 24/110 Ident% 21 Q: 175-279 (157)   S: 2-111 (195) predicted phosphopantetheine adenylyltransferase [uncultured proteobacterium EBAC31A08] Pos: 43/110 Gap: 5/110 Tw19Zk/z3bmRSA65FSm3JIlQCg8 15605797 8469191 7448378 2982950 161 E: 7E-24 Ident: 18/109 Ident% 16 Q: 174-278 (157)   S: 2-110 (161) lipopolysaccharide core biosynthesis protein [Aquifex aeolicus] Phosphopantetheine adenylyltransferase (Pantetheine-phosphate adenylyltransferase) (PPAT) (Dephospho-CoA pyrophosphorylase) lipopolysaccharide core biosynthesis protein - Aquifex aeolicus lipopolysaccharide core biosynthesis protein [Aquifex aeolicus] Pos: 40/109 Gap: 4/109 HFDg/ke8MdJ4+ABPxT5fEmbIlZ8 15612433 8469205 7448375 4155995 157 E: 6E-24 Ident: 18/108 Ident% 16 Q: 174-277 (157)   S: 2-109 (157) LIPOPOLYSACCHARIDE CORE BIOSYNTHESIS PROTEIN [Helicobacter pylori J99] Phosphopantetheine adenylyltransferase (Pantetheine-phosphate adenylyltransferase) (PPAT) (Dephospho-CoA pyrophosphorylase) lipopolysaccharide core biosynthesis protein - Helicobacter pylori (strain J99) LIPOPOLYSACCHARIDE CORE BIOSYNTHESIS PROTEIN [Helicobacter pylori J99] Pos: 40/108 Gap: 4/108 q05UrSMb7gsZC2nQkdNMdsuiv+M 15643504 8469200 7448380 4981266 161 E: 3E-25 Ident: 20/123 Ident% 16 Q: 176-294 (157)   S: 2-123 (161) lipopolysaccharide core biosynthesis protein KdtB [Thermotoga maritima] Phosphopantetheine adenylyltransferase (Pantetheine-phosphate adenylyltransferase) (PPAT) (Dephospho-CoA pyrophosphorylase) lipopolysaccharide core biosynthesis protein KdtB - Thermotoga maritima (strain MSB8) lipopolysaccharide core biosynthesis protein KdtB [Thermotoga maritima] Pos: 46/123 Gap: 5/123 KcjJMAAFJ44cjCZbBFzwfwVElJs 16078566 8469189 7448373 2340005 2633873 161 E: 2E-25 Ident: 22/106 Ident% 20 Q: 176-277 (157)   S: 4-109 (161) similar to lipopolysaccharide core biosynthesis [Bacillus subtilis] Phosphopantetheine adenylyltransferase (Pantetheine-phosphate adenylyltransferase) (PPAT) (Dephospho-CoA pyrophosphorylase) lipopolysaccharide core biosynthesis homolog ylbI - Bacillus subtilis similar to lipopolysaccharide core biosynthesis [Bacillus subtilis] Pos: 45/106 Gap: 4/106 RIkX40/47SjCQTUr4j33Vzl6ePY 15805669 8469199 7473097 6458344 167 E: 2E-25 Ident: 14/107 Ident% 13 Q: 177-277 (157)   S: 3-109 (167) lipopolysaccharide core biosynthesis protein KdtB [Deinococcus radiodurans] Phosphopantetheine adenylyltransferase (Pantetheine-phosphate adenylyltransferase) (PPAT) (Dephospho-CoA pyrophosphorylase) lipopolysaccharide core biosynthesis protein KdtB - Deinococcus radiodurans (strain R1) lipopolysaccharide core biosynthesis protein KdtB [Deinococcus radiodurans] Pos: 44/107 Gap: 6/107 oSsSmdfjEwaPj6xyCFmmihMtcPA 15603169 14194509 12721666 158 E: 4E-25 Ident: 25/145 Ident% 17 Q: 178-318 (157)   S: 5-144 (158) Phosphopantetheine adenylyltransferase (Pantetheine-phosphate adenylyltransferase) (PPAT) (Dephospho-CoA pyrophosphorylase) Pos: 48/145 Gap: 9/145 i3J81TKoBLpai5eQbIZmGlSD7n4 17545109 17427400 168 E: 4E-26 Ident: 21/108 Ident% 19 Q: 176-279 (157)   S: 3-110 (168) PROBABLE PHOSPHOPANTETHEINE ADENYLYLTRANSFERASE (PANTETHEINE-PHOSPHATE ADENYLYLTRANSFERASE) PROTEIN [Ralstonia solanacearum] PROBABLE PHOSPHOPANTETHEINE ADENYLYLTRANSFERASE (PANTETHEINE-PHOSPHATE ADENYLYLTRANSFERASE) PROTEIN [Ralstonia solanacearum] Pos: 42/108 Gap: 4/108 4lDhsighPPz9sSojHBNeVWupI1M 16272594 1170640 1074977 1573650 156 E: 9E-26 Ident: 22/114 Ident% 19 Q: 178-287 (157)   S: 5-116 (156) lipopolysaccharide core biosynthesis protein (kdtB) [Haemophilus influenzae Rd] Phosphopantetheine adenylyltransferase (Pantetheine-phosphate adenylyltransferase) (PPAT) (Dephospho-CoA pyrophosphorylase) lipopolysaccharide core biosynthesis protein (kdtB) [Haemophilus influenzae Rd] Pos: 43/114 Gap: 6/114 ajMOCvj3DL1VmRHu2mmA/qzDkZM 15675436 14194503 13622625 163 E: 6E-26 Ident: 35/198 Ident% 17 Q: 175-367 (157)   S: 4-161 (163) putative 3-deoxy-D-manno-octulosonic-acid transferase [Streptococcus pyogenes] [Streptococcus pyogenes M1 GAS] Phosphopantetheine adenylyltransferase (Pantetheine-phosphate adenylyltransferase) (PPAT) (Dephospho-CoA pyrophosphorylase) putative 3-deoxy-D-manno-octulosonic-acid transferase [Streptococcus pyogenes M1 GAS] Pos: 75/198 Gap: 45/198 Cf1ut+GkyQ4l3nvB5QJhsw2dV6g 15595560 14194513 11350784 9946214 159 E: 2E-27 Ident: 22/106 Ident% 20 Q: 178-279 (157)   S: 5-110 (159) phosphopantetheine adenylyltransferase [Pseudomonas aeruginosa] Phosphopantetheine adenylyltransferase (Pantetheine-phosphate adenylyltransferase) (PPAT) (Dephospho-CoA pyrophosphorylase) phosphopantetheine adenylyltransferase PA0363 [imported] - Pseudomonas aeruginosa (strain PAO1) phosphopantetheine adenylyltransferase [Pseudomonas aeruginosa] Pos: 39/106 Gap: 4/106 FIVRY6D7qGX8s2RaYJYyP0FbW+U 15895015 15024706 161 E: 1E-27 Ident: 19/109 Ident% 17 Q: 175-279 (157)   S: 2-110 (161) Phosphopantetheine adenylyltransferase [Clostridium acetobutylicum] Phosphopantetheine adenylyltransferase [Clostridium acetobutylicum] Pos: 44/109 Gap: 4/109 JNnTXb15rT6xW1Zb0iGf85NCUpE 16331739 8469197 7448372 1673325 159 E: 4E-27 Ident: 23/120 Ident% 19 Q: 176-291 (157)   S: 2-119 (159) Phosphopantetheine adenylyltransferase (Pantetheine-phosphate adenylyltransferase) (PPAT) (Dephospho-CoA pyrophosphorylase) Pos: 47/120 Gap: 6/120 sOT3cdrjDHtvf3TX1TCc2Ki6mng 14195644 7272369 166 E: 3E-27 Ident: 19/109 Ident% 17 Q: 177-281 (157)   S: 3-111 (166) Phosphopantetheine adenylyltransferase (Pantetheine-phosphate adenylyltransferase) (PPAT) (Dephospho-CoA pyrophosphorylase) Pos: 45/109 Gap: 4/109 /cZ54ZIEhBL5pzAcLSYI8eD6c6w 8469194 7448371 1518926 169 E: 6E-27 Ident: 22/109 Ident% 20 Q: 175-279 (157)   S: 2-110 (169) Phosphopantetheine adenylyltransferase (Pantetheine-phosphate adenylyltransferase) (PPAT) (Dephospho-CoA pyrophosphorylase) lipopolysaccharide core biosynthesis protein kdtB homolog - Chromatium vinosum Pos: 43/109 Gap: 4/109 fmVvU1o+byHlPqZmDNrAUWGfNUY 18310711 18145392 164 E: 3E-27 Ident: 23/108 Ident% 21 Q: 175-278 (157)   S: 2-109 (164) phosphopantetheine adenylyltransferase [Clostridium perfringens] phosphopantetheine adenylyltransferase [Clostridium perfringens] Pos: 47/108 Gap: 4/108 pn+pAzJyv2/587rhw2WUGMHjUYU 17232192 17133837 191 E: 4E-27 Ident: 20/121 Ident% 16 Q: 176-292 (157)   S: 2-120 (191) pantetheine-phosphate adenylyltransferase [Nostoc sp. PCC 7120] pantetheine-phosphate adenylyltransferase [Nostoc sp. PCC 7120] Pos: 48/121 Gap: 6/121 ezILO29O5p6pI4ee96tcBaCTBMs 15615152 14194521 10175210 165 E: 3E-28 Ident: 24/108 Ident% 22 Q: 176-279 (157)   S: 4-111 (165) pantetheine-phosphate adenylyltransferase; lipopolysaccharide core biosynthesis [Bacillus halodurans] pantetheine-phosphate adenylyltransferase; lipopolysaccharide core biosynthesis [Bacillus halodurans] Phosphopantetheine adenylyltransferase (Pantetheine-phosphate adenylyltransferase) (PPAT) (Dephospho-CoA pyrophosphorylase) pantetheine-phosphate adenylyltransferase [Bacillus halodurans] Pos: 45/108 Gap: 4/108 bWwSHdf5v46RZtBQDmLGN6w4lY0 15640252 14194524 11279489 9654630 164 E: 5E-28 Ident: 23/108 Ident% 21 Q: 178-281 (157)   S: 10-117 (164) lipopolysaccharide core biosynthesis protein KdtB [Vibrio cholerae] Phosphopantetheine adenylyltransferase (Pantetheine-phosphate adenylyltransferase) (PPAT) (Dephospho-CoA pyrophosphorylase) lipopolysaccharide core biosynthesis protein KdtB VC0222 [imported] - Vibrio cholerae (group O1 strain N16961) lipopolysaccharide core biosynthesis protein KdtB [Vibrio cholerae] Pos: 41/108 Gap: 4/108 aKYsEKcIpP1mnYxY3t7GB9F50gc 15924115 15926709 13700925 14246895 160 E: 4E-28 Ident: 23/107 Ident% 21 Q: 175-277 (157)   S: 4-110 (160) phosphopantetheine adenyltransferase homologue [Staphylococcus aureus subsp. aureus Mu50] phosphopantetheine adenyltransferase homolog [Staphylococcus aureus subsp. aureus N315] ORFID:SA0973~phosphopantetheine adenyltransferase homolog [Staphylococcus aureus subsp. aureus N315] phosphopantetheine adenyltransferase homologue [Staphylococcus aureus subsp. aureus Mu50] Pos: 48/107 Gap: 4/107 zFW1cQEiRpTB7RXnfG8e+T8AEog 18762502 106 E: 2E-28 Ident: 21/105 Ident% 20 Q: 174-274 (157)   S: 2-106 (106) phosphopantetheine adenyltransferase [Enterobacter aerogenes] Pos: 39/105 Gap: 4/105 /daOJAXmEOzXeIGyJPHKqC8wxo4 8469204 7480914 4007727 159 E: 7E-29 Ident: 24/123 Ident% 19 Q: 175-293 (157)   S: 2-121 (159) Phosphopantetheine adenylyltransferase (Pantetheine-phosphate adenylyltransferase) (PPAT) (Dephospho-CoA pyrophosphorylase) probable KDO transferase - Streptomyces coelicolor putative KDO transferase [Streptomyces coelicolor A3(2)] Pos: 52/123 Gap: 7/123 A5p+fDLKETIj5ckVn1k0rdftQ24 18762493 161 E: 1E-29 Ident: 23/112 Ident% 20 Q: 174-281 (157)   S: 2-113 (161) phosphopantetheine adenyltransferase [Proteus mirabilis] Pos: 41/112 Gap: 4/112 njHX0nC6LQbSDvAe/Vn1Yx2pjrs 16945743 160 E: 1E-29 Ident: 23/111 Ident% 20 Q: 175-281 (157)   S: 3-113 (160) phosphopantetheine adenylyltransferase [Photobacterium damselae subsp. piscicida] Pos: 43/111 Gap: 4/111 I/GIKr9BMVJ4pu2XLagBlR6WXNQ 16120406 15978168 159 E: 6E-29 Ident: 25/111 Ident% 22 Q: 175-281 (157)   S: 3-113 (159) phosphopantetheine adenylyltransferase [Yersinia pestis] phosphopantetheine adenylyltransferase [Yersinia pestis] Pos: 43/111 Gap: 4/111 Lc8plR1tVWov05jaknl9Kvx795I 16762584 16504889 159 E: 3E-31 Ident: 24/112 Ident% 21 Q: 174-281 (157)   S: 2-113 (159) phosphopantetheine adenylyltransferase [Salmonella enterica subsp. enterica serovar Typhi] phosphopantetheine adenylyltransferase [Salmonella enterica subsp. enterica serovar Typhi] Pos: 42/112 Gap: 4/112 DC3lovr1MXNlde+vXinJ4SIYBGc 16801224 16414672 161 E: 1E-31 Ident: 27/109 Ident% 24 Q: 173-277 (157)   S: 2-110 (161) similar to phosphopantetheine adenylyltransferase [Listeria innocua] similar to phosphopantetheine adenylyltransferase [Listeria innocua] Pos: 51/109 Gap: 4/109 4bYdh4GmW9ysEKmxSRkvHmZEgG8 16804091 16411522 160 E: 3E-31 Ident: 26/109 Ident% 23 Q: 173-277 (157)   S: 2-110 (160) similar to phosphopantetheine adenylyltransferase [Listeria monocytogenes EGD-e] similar to phosphopantetheine adenylyltransferase [Listeria monocytogenes] Pos: 51/109 Gap: 4/109 8cvlmuKC9efBheQ3U7dOHwkmKsg 8469202 5006992 159 E: 2E-31 Ident: 24/111 Ident% 21 Q: 175-281 (157)   S: 3-113 (159) Phosphopantetheine adenylyltransferase (Pantetheine-phosphate adenylyltransferase) (PPAT) (Dephospho-CoA pyrophosphorylase) Pos: 45/111 Gap: 4/111 eD4DzFKaaY2RrjheCSxT2bT1St0 8469201 4753138 18762511 161 E: 3E-31 Ident: 23/110 Ident% 20 Q: 176-281 (157)   S: 4-113 (161) Phosphopantetheine adenylyltransferase (Pantetheine-phosphate adenylyltransferase) (PPAT) (Dephospho-CoA pyrophosphorylase) phosphopantetheine adenylyltransferase CoaD [Serratia marcescens] phosphopantetheine adenyltransferase [Yersinia enterocolitica] Pos: 44/110 Gap: 4/110 59qJQGv4/d5NBT0YNmjI/25C/KY 16767010 16422293 159 E: 4E-32 Ident: 25/112 Ident% 22 Q: 174-281 (157)   S: 2-113 (159) phosphopantetheine adenylyltransferase [Salmonella typhimurium LT2] phosphopantetheine adenylyltransferase [Salmonella typhimurium LT2] Pos: 44/112 Gap: 4/112 jsnsvHO9GZkBpcSWR2JCgn64BU8 15804175 15833763 16131505 125331 78506 18655796 18655797 7767003 7767004 146544 146557 466772 1790065 12518390 13363984 159 E: 3E-32 Ident: 25/112 Ident% 22 Q: 174-281 (157)   S: 2-113 (159) putative enzyme of LPS biosynthesis [Escherichia coli O157:H7 EDL933] phosphopantetheine adenylyltransferase [Escherichia coli O157:H7] Phosphopantetheine adenylyltransferase (Pantetheine-phosphate adenylyltransferase) (PPAT) (Dephospho-CoA pyrophosphorylase) Chain A, Phosphopantetheine Adenylyltransferase In Complex With Mn2+ Atp From Escherichia Coli Chain A, Phosphopantetheine Adenylyltransferase In Complex With Mn2+ Atp From Escherichia Coli Chain B, Phosphopantetheine Adenylyltransferase In Complex With Mn2+ Atp From Escherichia Coli Chain B, Phosphopantetheine Adenylyltransferase In Complex With Mn2+ Atp From Escherichia Coli Chain A, Phosphopantetheine Adenylyltransferase In Complex With 3'- Dephospho-Coa From Escherichia Coli Chain B, Phosphopantetheine Adenylyltransferase In Complex With 3'- Dephospho-Coa From Escherichia Coli putative enzyme of LPS biosynthesis [Escherichia coli O157:H7 EDL933] phosphopantetheine adenylyltransferase [Escherichia coli O157:H7] Pos: 44/112 Gap: 4/112 2n/Z1PxOOD5T5WpCETlDLxok/18 8469192 11279491 3150221 160 E: 5E-32 Ident: 26/119 Ident% 21 Q: 178-292 (157)   S: 5-120 (160) Phosphopantetheine adenylyltransferase (Pantetheine-phosphate adenylyltransferase) (PPAT) (Dephospho-CoA pyrophosphorylase) lipopolysaccharide core biosynthesis protein [imported] - Mycobacterium leprae lipopolysaccharide core biosynthesis protein [Mycobacterium leprae] Pos: 52/119 Gap: 7/119 oWbSPLMlPCFUbfshb5r/06B7+Dk 14719581 14719582 158 E: 4E-32 Ident: 25/112 Ident% 22 Q: 174-281 (157)   S: 1-112 (158) Chain A, Phosphopantetheine Adenylytransferase From Escherichia Coli In Complex With 4'-Phosphopantetheine Chain B, Phosphopantetheine Adenylytransferase From Escherichia Coli In Complex With 4'-Phosphopantetheine Pos: 44/112 Gap: 4/112 bZp/3P9+IBJ0PTZ+ETppPTgQSTM 15827880 13093433 157 E: 5E-32 Ident: 26/119 Ident% 21 Q: 178-292 (157)   S: 2-117 (157) probable phosphopantetheine adenylyltransferase [Mycobacterium leprae] probable phosphopantetheine adenylyltransferase [Mycobacterium leprae] Pos: 52/119 Gap: 7/119 mtA1jYRZs0Dtmusu2/Hgpg6Q3eE 15610102 15842518 8469195 2146002 7448374 560525 1694866 13882827 161 E: 7E-34 Ident: 26/120 Ident% 21 Q: 177-292 (157)   S: 4-120 (161) lipopolysaccharide core biosynthesis protein KdtB [Mycobacterium tuberculosis CDC1551] PHOSPHOPANTETHEINE ADENYLYLTRANSFERASE (PANTETHEINE-PHOSPHATE ADENYLYLTRANSFERASE) (PPAT) (DEPHOSPHO-COA PYROPHOSPHORYLASE) lipopolysaccharide core biosynthesis protein KdtB [Mycobacterium tuberculosis CDC1551] Pos: 50/120 Gap: 7/120 CNvvX3JJ/NqjnK2C67Rq3vzxk8o 15903825 15459467 162 E: 3E-39 Ident: 41/193 Ident% 21 Q: 174-364 (157)   S: 3-158 (162) lipopolysaccharide core biosynthesis protein [Streptococcus pneumoniae R6] lipopolysaccharide core biosynthesis protein [Streptococcus pneumoniae R6] Pos: 66/193 Gap: 39/193 tlV3lBg9f6v3ugxQCyY6/P4BhbE 15901791 14973475 162 E: 1E-40 Ident: 41/193 Ident% 21 Q: 174-364 (157)   S: 3-158 (162) phosphopantetheine adenylyltransferase [Streptococcus pneumoniae TIGR4] phosphopantetheine adenylyltransferase [Streptococcus pneumoniae TIGR4] Pos: 66/193 Gap: 39/193 JOlzlgPd5bhC3R0spo2scyyPyVA 5921790 3413797 338 E: 6E-93 Ident: 105/344 Ident% 30 Q: 47-378 (157)   S: 2-334 (338) [Citrate [pro-3S]-lyase] ligase (Citrate lyase synthetase) (Acetate:SH-citrate lyase ligase) [Citrate [pro-3S]-lyase] ligase (Citrate lyase synthetase) (Acetate:SH-citrate lyase ligase) citrate lyase ligase [Leuconostoc mesenteroides] Pos: 169/344 Gap: 23/344 8VWqt8E3dAyI0T/hgKSMXR2rYVg 11279326 6249491 350 E: 2E-99 Ident: 108/353 Ident% 30 Q: 39-378 (157)   S: 8-346 (350) citrate (pro-3S)-lyase ligase (EC 6.2.1.22) [imported] - Weissella paramesenteroides plasmid putative citrate lyase ligase [Weissella paramesenteroides] Pos: 175/353 Gap: 27/353 EfQq1gvdK8UpYHgHLa9r9pMJWbE 15673170 12724155 346 E: 1E-101 Ident: 119/345 Ident% 34 Q: 47-379 (157)   S: 5-343 (346) acetate-SH-citrate lyase ligase (EC 6.2.1.22) [Lactococcus lactis subsp. lactis] acetate-SH-citrate lyase ligase (EC 6.2.1.22) [Lactococcus lactis subsp. lactis] Pos: 182/345 Gap: 18/345 WPGr2W4dzTubmzSkV9tKSB87rEg 18310128 18144807 345 E: 1E-103 Ident: 124/334 Ident% 37 Q: 34-365 (157)   S: 14-342 (345) citrate (pro-3S)-lyase ligase [Clostridium perfringens] citrate (pro-3S)-lyase ligase [Clostridium perfringens] Pos: 195/334 Gap: 7/334 28sLIh9Xik5SmK7RUUAdcU4ceoE 15675161 13622324 350 E: 1E-110 Ident: 117/346 Ident% 33 Q: 35-379 (157)   S: 5-344 (350) putative citrate lyase synthetase (citrate (pro-3S)-lyase ligase) [Streptococcus pyogenes] [Streptococcus pyogenes M1 GAS] putative citrate lyase synthetase (citrate (pro-3S)-lyase ligase) [Streptococcus pyogenes] [Streptococcus pyogenes M1 GAS] putative citrate lyase synthetase (citrate (pro-3S)-lyase ligase) [Streptococcus pyogenes M1 GAS] putative citrate lyase synthetase (citrate (pro-3S)-lyase ligase) [Streptococcus pyogenes M1 GAS] Pos: 187/346 Gap: 7/346 2+VOKm/12pdXn4DBfJkcAP60aN0 16272000 1168960 1073940 1572970 335 E: 1E-120 Ident: 173/330 Ident% 52 Q: 36-364 (157)   S: 3-331 (335) citrate lyase ligase (citC) [Haemophilus influenzae Rd] [Citrate [pro-3S]-lyase] ligase (Citrate lyase synthetase) (Acetate:SH-citrate lyase ligase) [Citrate [pro-3S]-lyase] ligase (Citrate lyase synthetase) (Acetate:SH-citrate lyase ligase) citrate (pro-3S)-lyase ligase (EC 6.2.1.22) - Haemophilus influenzae (strain Rd KW20) citrate lyase ligase (citC) [Haemophilus influenzae Rd] Pos: 231/330 Gap: 2/330 jofioAayZSrzJz3Bo3WyZO1n/eE 16763448 16418554 347 E: 1E-124 Ident: 163/342 Ident% 47 Q: 33-373 (157)   S: 6-347 (347) putative citrate lyase synthetase (citrate (pro-3S)-lyase ligase [Salmonella typhimurium LT2] putative citrate lyase synthetase (citrate (pro-3S)-lyase ligase [Salmonella typhimurium LT2] putative citrate lyase synthetase (citrate (pro-3S)-lyase ligase [Salmonella typhimurium LT2] putative citrate lyase synthetase (citrate (pro-3S)-lyase ligase [Salmonella typhimurium LT2] Pos: 228/342 Gap: 1/342 gkALDjTFlVXVO1n8BhM98sPIILc 1168961 2126129 565616 342 E: 1E-124 Ident: 174/341 Ident% 51 Q: 34-373 (157)   S: 3-342 (342) [Citrate [pro-3S]-lyase] ligase (Citrate lyase synthetase) (Acetate:SH-citrate lyase ligase) [Citrate [pro-3S]-lyase] ligase (Citrate lyase synthetase) (Acetate:SH-citrate lyase ligase) citrate (pro-3S)-lyase ligase (EC 6.2.1.22) - Klebsiella pneumoniae acetate:SH-citrate lyase ligase (AMP) [Klebsiella pneumoniae] Pos: 231/341 Gap: 2/341 g+ylUfU4Z2ZbLvks6hDIU20VWTc 16759052 16501342 347 E: 1E-125 Ident: 164/342 Ident% 47 Q: 33-373 (157)   S: 6-347 (347) [citrate (PRO-3S)-lyase] ligase [Salmonella enterica subsp. enterica serovar Typhi] [citrate (PRO-3S)-lyase] ligase [Salmonella enterica subsp. enterica serovar Typhi] Pos: 227/342 Gap: 1/342 0IlbcFmLffIkgBPI1tiaGXU3kaw 15640814 11279325 9655245 356 E: 1E-127 Ident: 172/340 Ident% 50 Q: 35-373 (157)   S: 11-350 (356) citrate (pro-3S)-lyase ligase [Vibrio cholerae] citrate (pro-3S)-lyase ligase VC0796 [imported] - Vibrio cholerae (group O1 strain N16961) citrate (pro-3S)-lyase ligase [Vibrio cholerae] Pos: 224/340 Gap: 1/340 M3GucKkbIBucQkdu4/elolVcmrQ 16759584 16501876 341 E: 1E-134 Ident: 289/334 Ident% 86 Q: 47-380 (157)   S: 1-334 (341) [citrate (pro-3S)-lyase] ligase [Salmonella enterica subsp. enterica serovar Typhi] [citrate (pro-3S)-lyase] ligase [Salmonella enterica subsp. enterica serovar Typhi] Pos: 306/334 Gap: -1/-1 MU4T5aCMPzWcMmIue9orm9gz+OY 16764001 16419135 358 E: 1E-142 Ident: 305/351 Ident% 86 Q: 30-380 (157)   S: 1-351 (358) citrate lyase synthetase (citrate (pro-3S)-lyase ligase [Salmonella typhimurium LT2] citrate lyase synthetase (citrate (pro-3S)-lyase ligase [Salmonella typhimurium LT2] citrate lyase synthetase (citrate (pro-3S)-lyase ligase [Salmonella typhimurium LT2] citrate lyase synthetase (citrate (pro-3S)-lyase ligase [Salmonella typhimurium LT2] Pos: 323/351 Gap: -1/-1 YIlv2ielOZdjicvOxDMMDZW2UcU 2498241 3172142 352 E: 1E-149 Ident: 352/352 Ident% 100 Q: 30-381 (157)   S: 1-352 (352) [CITRATE [PRO-3S]-LYASE] LIGASE (CITRATE LYASE SYNTHETASE) (ACETATE:SH-CITRATE LYASE LIGASE) [CITRATE [PRO-3S]-LYASE] LIGASE (CITRATE LYASE SYNTHETASE) (ACETATE:SH-CITRATE LYASE LIGASE) citrate lyase ligase [Escherichia coli] Pos: 352/352 Gap: -1/-1 TKI+4Drp5d3UAlp+0Zzi/xmYuo8 4062235 4062241 371 E: 1E-160 Ident: 370/371 Ident% 99 Q: 11-381 (157)   S: 1-371 (371) Citrate (pro-3S)-lyase ligase homolog [Escherichia coli] Citrate (pro-3S)-lyase ligase homolog [Escherichia coli] Pos: 371/371 Gap: -1/-1 KBwVIjws2ei6lFZehlgK6MPD2fg 15800333 15829911 12513517 13360115 381 E: 1E-163 Ident: 378/381 Ident% 99 Q: 1-381 (157)   S: 1-381 (381) citrate lyase synthetase (citrate (pro-3S)-lyase ligase [Escherichia coli O157:H7 EDL933] citrate lyase synthetase (citrate (pro-3S)-lyase ligase [Escherichia coli O157:H7 EDL933] citrate lyase synthetase (citrate (pro-3S)-lyase ligase [Escherichia coli O157:H7] citrate lyase synthetase (citrate (pro-3S)-lyase ligase [Escherichia coli O157:H7] citrate lyase synthetase (citrate (pro-3S)-lyase ligase [Escherichia coli O157:H7 EDL933] citrate lyase synthetase (citrate (pro-3S)-lyase ligase [Escherichia coli O157:H7 EDL933] citrate lyase synthetase (citrate (pro-3S)-lyase ligase [Escherichia coli O157:H7] citrate lyase synthetase (citrate (pro-3S)-lyase ligase [Escherichia coli O157:H7] Pos: 378/381 Gap: -1/-1 3tDWJBUQ+6tCW8kAhgxsuC+vapc 16128601 7447948 1778535 1786835 381 E: 1E-165 Ident: 381/381 Ident% 100 Q: 1-381 (157)   S: 1-381 (381) citrate lyase synthetase (citrate (pro-3S)-lyase ligase [Escherichia coli K12] citrate lyase synthetase (citrate (pro-3S)-lyase ligase [Escherichia coli K12] citrate (pro-3S)-lyase ligase (EC 6.2.1.22) - Escherichia coli citrate lyase synthetase (citrate (pro-3S)-lyase ligase [Escherichia coli K12] citrate lyase synthetase (citrate (pro-3S)-lyase ligase [Escherichia coli K12] Pos: 381/381 Gap: -1/-1
prev. next SHA1: bgCDA+hA09VNQONbHvQgct18FwM 15800346 16128615 118224 72511 41212 1651259 1786851 12513533	D-alanyl-D-alanine carboxypeptidase, fraction A; penicillin-binding protein 5 [Escherichia coli O157:H7 EDL933]	375	0	150	519	659	2N3+Iw9NADpzZOTGr1x8120qWpY 15823982 3970 E: 4.1E0 Ident: 12/56 Ident% 21 Q: 233-284 (375)   S: 467-522 (3970) modular polyketide synthase [Streptomyces avermitilis] Pos: 26/56 Gap: 4/56 7wmzc1XBTwMRo0PBwkmnG+6zzKo 15832700 13362917 218 E: 5.1E0 Ident: 21/86 Ident% 24 Q: 165-250 (375)   S: 49-131 (218) uracil-DNA-glycosylase [Escherichia coli O157:H7] uracil-DNA-glycosylase [Escherichia coli O157:H7] Pos: 29/86 Gap: 3/86 roiYTFY1rNMLVISLKto/bWAbClk 15807944 7473894 6460774 728 E: .65E0 Ident: 10/57 Ident% 17 Q: 10-66 (375)   S: 7-63 (728) serine protease, subtilase family [Deinococcus radiodurans] serine protease, subtilase family [Deinococcus radiodurans] Pos: 24/57 Gap: -1/-1 V3QMjAyk8fAvp8L12IrGUU1+5Ok 15803107 12517001 229 E: 5.1E0 Ident: 21/86 Ident% 24 Q: 165-250 (375)   S: 49-131 (229) uracil-DNA-glycosylase [Escherichia coli O157:H7 EDL933] uracil-DNA-glycosylase [Escherichia coli O157:H7 EDL933] Pos: 29/86 Gap: 3/86 pvySJ66xt28ocWX37Opi3jLAIz0 4127525 389 E: 1.5E0 Ident: 14/88 Ident% 15 Q: 46-133 (375)   S: 80-154 (389) D-stereospecific peptide hydrolase [Bacillus cereus] Pos: 30/88 Gap: 13/88 B/0p4svVEVO9dorhNVnhnWWbmoA 1245828 52 E: 3E-4 Ident: 14/52 Ident% 26 Q: 27-77 (375)   S: 1-52 (52) beta-lactamase=penicillinase/penicillin amino beta-lactam-hydrolase {N-terminal} {EC 3.5.2.6} [Shigella flexneri, USCF-129, Peptide Partial, 52 aa] Pos: 21/52 Gap: 1/52 GnVMIBt9obGAYw7HwiLMvTFd3E4 11322396 393 E: 2E-4 Ident: 27/132 Ident% 20 Q: 47-175 (375)   S: 59-166 (393) putative hydrolase [Streptomyces coelicolor] Pos: 48/132 Gap: 27/132 j2/Hwmd9qe2SLT/TnkmWMM0I7xc 461628 282540 216999 312 E: 1E-14 Ident: 24/131 Ident% 18 Q: 47-177 (375)   S: 22-141 (312) BETA-LACTAMASE REGULATORY PROTEIN BLAB BETA-LACTAMASE REGULATORY PROTEIN BLAB activator-regulator protein BlaB - Streptomyces cacaoi regulatory protein for beta-lactamase [Streptomyces cacaoi] regulatory protein for beta-lactamase [Streptomyces cacaoi] Pos: 47/131 Gap: 11/131 xvXRjsnl0Oy6K1hBK2SEsZRvf8k 96551 251981 263 E: 3E-25 Ident: 39/244 Ident% 15 Q: 29-268 (375)   S: 3-236 (263) beta-lactamase, penicillin amido-beta-lactam hydrolase {EC 3.5.2.6} [Escherichia coli, strain MEN-1, Peptide Plasmid, 263 aa] Pos: 69/244 Gap: 14/244 F8VP/2yfcLxStqHJI42FMsLk5sg 595993 1197550 14164988 190 E: 3E-32 Ident: 35/181 Ident% 19 Q: 17-191 (375)   S: 8-180 (190) truncated beta-lactamase gene with a 4bp deletion, repaired by mutagenesis with oligo GTTGCCATTGCTGCAGGCATCGTGGTG (nucleotides 4573-4595) restoring ampicillin resistance and PstI site by 4 bp insertion [Cloning vector pSIT] Pos: 65/181 Gap: 14/181 sK3Kd1+yGcPGf5hkTic4WgfrjeU 10956148 10956150 628265 11266199 58162 58165 58183 58185 58189 58191 58195 58198 58200 58206 58218 58221 58224 58227 58230 58232 58234 58236 58238 58240 58242 58245 146582 173016 208895 208898 387897 403938 434647 434651 434654 440201 452345 452347 453623 453627 455365 455366 455367 455371 460936 460940 460944 469219 499100 520998 531831 531835 537454 537457 537460 537463 537466 537469 537472 537475 537478 537481 537486 540253 559519 567891 567894 575448 595704 595763 595766 595769 595771 595776 595778 595781 603173 603176 603180 603184 644833 644836 682655 691758 806874 806877 806880 806882 806888 806891 806893 833824 894141 915334 984891 984894 984897 984900 984903 984906 984908 984911 984919 984922 984925 984928 984930 988212 1016009 1045527 1045529 1045582 1045588 1045594 1045600 1049258 1049261 1052970 1073247 1132427 1144477 1144524 1150735 1197673 1197676 1197678 1197681 1197684 1200458 1200461 1200464 1200467 1200470 1200492 1200495 1200498 1228976 1228978 1228980 1277159 1277161 1335983 1335986 1335989 1335992 1335995 1345435 1354499 1373275 1377903 1377905 1377907 1399734 1399737 1399740 1399743 1488685 1490530 1515458 1527193 1561768 1561770 1595818 1595822 1595826 1595830 1595834 1595838 1595842 1595846 1595850 1649039 1680652 1684625 1684628 1685275 1685277 1698775 1724063 1769872 1769879 1834348 1834351 1842042 1899164 1899168 1899171 1902779 1902897 2058307 2071946 2190697 2190702 2190705 2190708 2190710 2190713 2190715 2190719 2190724 2190727 2190730 2190733 2208942 2218118 2218121 2218145 2239040 2267565 2281527 2293132 2342751 2353793 2358011 2440158 2440161 2462914 2462916 2462920 2522427 2582511 2582514 2582517 2582520 2598099 2598102 2598105 2598108 2623119 2623122 2623125 2623128 2623974 2623980 2623982 2623986 2654778 2656022 2739059 2739065 2739069 2769263 2801656 2801658 2801660 2801662 2801664 2801666 2852396 2961157 2981188 2981193 3002524 3025716 3108235 3114618 3123922 3136319 3136323 3243010 3243013 3243016 3243018 3243021 3243024 3243027 3243030 3273768 3273770 3435309 3808122 3834581 3882023 4028600 4097014 4097016 4097018 4097020 4210486 4379389 4455912 4455915 4455918 4704644 4732039 4959728 5006905 5354162 5420150 5420375 5441564 5531233 5640090 5701826 5702092 5733495 5758123 5758125 5758127 5758129 5758131 5758133 5758135 5802284 5802288 5802293 5834245 5929924 6010469 6010472 6010475 6010478 6318859 6318867 6457292 6457302 6457308 6457347 6467481 6467487 6687357 6782313 6782315 6822255 6901347 7108473 7108477 7340793 7380885 7637910 7715979 7799032 7799035 8037918 8050588 8216947 8216949 8216951 8216953 8216955 8250169 8272486 8346633 8346636 8346639 8346642 8843953 9587165 9587170 9857880 9857883 9857886 9857890 9857894 9857897 9857901 10504975 11061109 11061116 11061122 11344868 11344872 11344876 11344880 11344884 11344887 11344891 11344894 11344898 11344901 11344905 11344908 11344911 11344914 11344917 11344920 11991617 12034710 12034713 12082763 12584847 12698838 12698840 12698915 12831144 12958277 12965139 13027703 13161002 13236870 13345298 13346452 13508479 14009670 14009673 14039716 14039720 14039724 14039728 14039732 14039736 14039740 14290103 14456626 14517315 14594738 14594742 14594746 14594750 14594754 14594758 14594762 14594766 14594770 14594774 14594796 14994092 14994095 14994097 14994099 15072759 15072762 15072765 15072768 15148787 15554331 15554334 15554337 15554344 15554351 15778425 15982215 16118710 16209074 16209080 16209085 16209091 16209097 16209116 16209123 16209130 16209135 16209142 16209185 16904154 16904157 16904160 16904163 16904166 16904169 16904172 16904175 16904178 16904181 16904184 16904187 16930721 16930724 17530180 17530183 17530187 18140171 18252135 18766964 286 E: 4E-34 Ident: 45/276 Ident% 16 Q: 17-283 (375)   S: 8-273 (286) beta lactamase [DNA-binding vector pODB80] beta lactamase [Cloning vector pVLH/hsp] Pos: 90/276 Gap: 19/276 /CVztTRm7d1SsHxZljbFNPuKmts 112565 45615 208142 208903 208989 209068 209520 209527 1658407 2293123 2343027 2343032 2343038 2343043 2343049 2343053 2576370 2576374 2576378 3320601 3892177 4545267 4545275 4585225 5326972 5326976 5327021 5327025 5327030 6009636 6010636 6457352 7649701 7649704 9022391 9587162 10945111 11934666 11934670 13160950 13623802 13623805 15149222 286 E: 4E-34 Ident: 45/276 Ident% 16 Q: 17-283 (375)   S: 8-273 (286) beta-lactamhydrolase [Expression vector pLEAD4] beta-lactamhydrolase [Expression vector pLEAD5] Pos: 90/276 Gap: 19/276
prev. next SHA1: v4ATo4+Ge+q27kVj8F36bTEu2Gw 16128027 115627 68663 18158903 18158905 18158907 18158909 4929935 4929937 4929939 4929941 3318829 6730187 6730189 6730191 6730193 6730116 6730118 6730120 6730122 6730126 6730128 6730130 6730132 3318817 3318821 3318825 41079 145464 216460 1786216	carbamoyl-phosphate synthase large subunit [Escherichia coli K12]	2346	0	463	1084	1200	ngnssKUzYc0h+rf8oyrx3ng6fsc 13177676 13938557 314 E: .2E0 Ident: 31/237 Ident% 13 Q: 645-848 (2346)   S: 76-302 (314) Similar to inositol 1,3,4-triphosphate 5/6 kinase [Homo sapiens] Similar to inositol 1,3,4-triphosphate 5/6 kinase [Homo sapiens] Pos: 81/237 Gap: 43/237 0IC2IQGSXS+UZvDiG79DFxIdPx8 15964091 15073267 315 E: 6E0 Ident: 22/160 Ident% 13 Q: 144-301 (2346)   S: 138-284 (315) PROBABLE GLUTATHIONE SYNTHETASE PROTEIN [Sinorhizobium meliloti] PROBABLE GLUTATHIONE SYNTHETASE PROTEIN [Sinorhizobium meliloti] Pos: 47/160 Gap: 15/160 pEz3un6bWPZKdvSJvv0gprKZmq8 18309991 18144670 119 E: .055E0 Ident: 21/112 Ident% 18 Q: 947-1049 (2346)   S: 5-114 (119) methylglyoxal synthase [Clostridium perfringens] methylglyoxal synthase [Clostridium perfringens] Pos: 35/112 Gap: 11/112 In7Sz4NCLyDWwmWfyGXXxRl4GQw 16078616 115626 98246 143390 2633925 1071 E: 0E0 Ident: 530/1075 Ident% 49 Q: 1-1067 (2346)   S: 1-1066 (1071) carbamoyl-phosphate synthetase (catalytic subunit) [Bacillus subtilis] Carbamoyl-phosphate synthase, pyrimidine-specific, large chain (Carbamoyl-phosphate synthetase ammonia chain) Carbamoyl-phosphate synthase, pyrimidine-specific, large chain (Carbamoyl-phosphate synthetase ammonia chain) carbamoyl-phosphate synthase (glutamine-hydrolyzing) (EC 6.3.5.5), pyrimidine-repressible, large chain pyrAB - Bacillus subtilis carbamyl phosphate synthetase [Bacillus subtilis] carbamoyl-phosphate synthetase (catalytic subunit) [Bacillus subtilis] Pos: 740/1075 Gap: 17/1075 jEp8eUChAJuvQCB387EyxsdHNWU 1872144 1028 E: 0E0 Ident: 557/1080 Ident% 51 Q: 1-1069 (2346)   S: 1-1022 (1028) carbamoyl-phosphate synthase (glutamine-hydrolysing) large subunit [Thermus thermophilus] Pos: 716/1080 Gap: 69/1080 497s02igPCWuQcU4lVrMpl5SRig 14724922 4033707 3228248 5020420 1500 E: 0E0 Ident: 430/1082 Ident% 39 Q: 4-1071 (2346)   S: 419-1494 (1500) carbamoyl-phosphate synthetase 1, mitochondrial [Homo sapiens] CARBAMOYL-PHOSPHATE SYNTHASE [AMMONIA], MITOCHONDRIAL PRECURSOR (CARBAMOYL-PHOSPHATE SYNTHETASE I) (CPSASE I) CARBAMOYL-PHOSPHATE SYNTHASE [AMMONIA], MITOCHONDRIAL PRECURSOR (CARBAMOYL-PHOSPHATE SYNTHETASE I) (CPSASE I) carbamoyl phosphate synthetase 1 [Homo sapiens] carbamyl phosphate synthetase I [Homo sapiens] Pos: 666/1082 Gap: 20/1082 JZqFp8WACEetRi8ZEJmLd1Vtstg 15677690 11272706 7227111 1071 E: 0E0 Ident: 742/1074 Ident% 69 Q: 1-1073 (2346)   S: 1-1068 (1071) carbamoyl-phosphate synthase, large subunit [Neisseria meningitidis MC58] carbamoyl-phosphate synthase (glutamine-hydrolyzing) (EC 6.3.5.5) large chain NMB1855 [similarity] - Neisseria meningitidis (group B strain MD58) carbamoyl-phosphate synthase, large subunit [Neisseria meningitidis MC58] Pos: 872/1074 Gap: 7/1074 aRIjhThcK+H8kM9L/2z3bm5yEuc 15679424 3025121 7482768 2622538 534 E: 6.7E0 Ident: 30/181 Ident% 16 Q: 87-246 (2346)   S: 273-451 (534) Putative O-sialoglycoprotein endopeptidase (Glycoprotease) Pos: 46/181 Gap: 23/181 zYhlysSIC2U64SVjJO9KzRsOU5o 86162 326 E: 2.4E0 Ident: 15/105 Ident% 14 Q: 333-430 (2346)   S: 12-107 (326) acetyl-CoA carboxylase (EC 6.4.1.2) - chicken (fragment) Pos: 32/105 Gap: 16/105 TKnWmHfEYBr0CQBhRRz3XhsWvfk 15673345 12724347 1064 E: 0E0 Ident: 523/1067 Ident% 49 Q: 1-1058 (2346)   S: 1-1058 (1064) carbamoylphosphate synthetase [Lactococcus lactis subsp. lactis] carbamoylphosphate synthetase [Lactococcus lactis subsp. lactis] Pos: 712/1067 Gap: 18/1067 reg+jAEWEOryZDhRzGtGADEF84M 18893879 1056 E: 0E0 Ident: 430/1071 Ident% 40 Q: 4-1071 (2346)   S: 2-1036 (1056) carbamoyl-phosphate synthase large chain (glutamine-hydrolysing) [Pyrococcus furiosus DSM 3638] Pos: 637/1071 Gap: 39/1071 2bek2gi4zfOEfZr5lLtfYsOYXcA 3766203 404 E: 2.2E0 Ident: 8/50 Ident% 16 Q: 676-724 (2346)   S: 15-64 (404) GTP-specific succinyl-CoA synthetase beta subunit [Mus musculus] GTP-specific succinyl-CoA synthetase beta subunit [Mus musculus] GTP-specific succinyl-CoA synthetase beta subunit [Mus musculus] GTP-specific succinyl-CoA synthetase beta subunit [Mus musculus] Pos: 20/50 Gap: 1/50 NZZ6Y0wJBTUpBRDI2S2i2stBj8A 16131836 131639 66486 42595 147420 396345 1790439 529 E: .029E0 Ident: 22/48 Ident% 45 Q: 944-991 (2346)   S: 9-54 (529) phosphoribosylaminoimidazolecarboxamideformyltransferase = AICAR formyltransferase; IMP cyclohydrolase [Escherichia coli K12] phosphoribosylaminoimidazolecarboxamideformyltransferase = AICAR formyltransferase; IMP cyclohydrolase [Escherichia coli K12] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] phosphoribosylaminoimidazolecarboxamide formyltransferase and IMP cyclohydrolase (bifunctional enzyme) [Escherichia coli] phosphoribosylaminoimidazolecarboxamide formyltransferase and IMP cyclohydrolase (bifunctional enzyme) [Escherichia coli] phosphoribosylaminoimidazolecarboxamideformyltransferase = AICAR formyltransferase; IMP cyclohydrolase [Escherichia coli K12] phosphoribosylaminoimidazolecarboxamideformyltransferase = AICAR formyltransferase; IMP cyclohydrolase [Escherichia coli K12] Pos: 28/48 Gap: 2/48 eUt4vlqdstR8BCWcaoUl7Zr9n1o 8218209 394 E: .031E0 Ident: 29/200 Ident% 14 Q: 676-844 (2346)   S: 6-193 (394) succinyl-CoA synthetase beta chain [Streptomyces coelicolor A3(2)] succinyl-CoA synthetase beta chain [Streptomyces coelicolor A3(2)] Pos: 60/200 Gap: 43/200 fHY2vbU5Wp2GYF37Ym56GzK4am0 15080775 1027 E: .006E0 Ident: 34/263 Ident% 12 Q: 609-861 (2346)   S: 547-791 (1027) protein kinase NYD-SP5 [Homo sapiens] Pos: 83/263 Gap: 28/263 T+RprCNOmtTwZdKZ5RJIb0PJn+4 17539378 1710876 7497783 1118094 415 E: .33E0 Ident: 18/127 Ident% 14 Q: 132-233 (2346)   S: 27-153 (415) succinyl-CoA synthetase beta chain [Caenorhabditis elegans] PROBABLE SUCCINYL-COA LIGASE [GDP-FORMING] BETA-CHAIN, MITOCHONDRIAL PRECURSOR (SUCCINYL-COA SYNTHETASE, BETA CHAIN) (SCS-BETA) PROBABLE SUCCINYL-COA LIGASE [GDP-FORMING] BETA-CHAIN, MITOCHONDRIAL PRECURSOR (SUCCINYL-COA SYNTHETASE, BETA CHAIN) (SCS-BETA) Pos: 39/127 Gap: 25/127 Bi3IGqS/oaRT5qNjVSPU0DUn3L0 5499725 1505 E: 0E0 Ident: 436/1080 Ident% 40 Q: 1-1065 (2346)   S: 415-1488 (1505) carbamoyl-phosphate synthetase III [Alcolapia grahami] Pos: 660/1080 Gap: 21/1080 PoCnr1LH5CPxhHyEbxBFJlPy5NQ 15674870 13622006 1058 E: 0E0 Ident: 519/1060 Ident% 48 Q: 1-1057 (2346)   S: 1-1051 (1058) putative carbamoylphosphate synthetase [Streptococcus pyogenes] [Streptococcus pyogenes M1 GAS] putative carbamoylphosphate synthetase [Streptococcus pyogenes M1 GAS] Pos: 737/1060 Gap: 12/1060 YHgY+vK37VqOmUJ+Xq3dAZO2b/M 7657244 1322038 414 E: .14E0 Ident: 31/236 Ident% 13 Q: 645-847 (2346)   S: 76-301 (414) inositol 1,3,4-triphosphate 5/6 kinase; inositol 1,3,4-trisphosphate 5/6 kinase [Homo sapiens] inositol 1,3,4-trisphosphate 5/6-kinase [Homo sapiens] inositol 1,3,4-triphosphate 5/6 kinase; inositol 1,3,4-trisphosphate 5/6 kinase [Homo sapiens] inositol 1,3,4-trisphosphate 5/6-kinase [Homo sapiens] Pos: 81/236 Gap: 43/236 rwvpnLeDBl4icOhLNltXCaPm49A 6006568 1020 E: 0E0 Ident: 452/1056 Ident% 42 Q: 1-1051 (2346)   S: 1-1011 (1020) carbamoyl-phosphate synthase large subunit [Lactobacillus plantarum] Pos: 622/1056 Gap: 50/1056 KYij3v909xE0muu70ghooTPJrb8 15892522 15619682 386 E: .035E0 Ident: 10/73 Ident% 13 Q: 676-743 (2346)   S: 6-78 (386) succinyl-CoA synthetase beta chain [EC:6.2.1.5] [Rickettsia conorii] succinyl-CoA synthetase beta chain [EC:6.2.1.5] [Rickettsia conorii] succinyl-CoA synthetase beta chain [EC:6.2.1.5] [Rickettsia conorii] succinyl-CoA synthetase beta chain [EC:6.2.1.5] [Rickettsia conorii] Pos: 26/73 Gap: 5/73 vjQdsAFBFjhJZNw0WNf+30h/Fl8 5514636 726 E: 1.2E0 Ident: 14/99 Ident% 14 Q: 132-215 (2346)   S: 504-601 (726) acetyl-CoA synthetase [Giardia intestinalis] acetyl-CoA synthetase [Giardia intestinalis] Pos: 27/99 Gap: 16/99 B5/38pvkIgBKwNqeIJ7iFWyQ38k 3912935 1043 E: 0E0 Ident: 465/1079 Ident% 43 Q: 1-1072 (2346)   S: 1-1031 (1043) carbamoylphosphate synthetase heavy subunit [Geobacillus stearothermophilus] Pos: 663/1079 Gap: 55/1079 yemVrUu8fruXrgPc4ow5hjw0Kgk 10639761 205 E: .76E0 Ident: 13/79 Ident% 16 Q: 799-871 (2346)   S: 2-80 (205) phosphoribosylamide-glycine ligase related protein [Thermoplasma acidophilum] Pos: 27/79 Gap: 6/79 c9IxzUeIbWn2GViWlRwuUVjCUkA 1072978 451653 26 E: .009E0 Ident: 26/26 Ident% 100 Q: 1-26 (2346)   S: 1-26 (26) carbamoyl-phosphate synthase (glutamine-hydrolyzing) (EC 6.3.5.5) large chain - Pseudomonas aeruginosa (fragment) carbamoyl phosphate synthetase heavy subunit [Pseudomonas aeruginosa] Pos: 26/26 Gap: -1/-1 SbZvY+c2tg098pE/sezKQp+3cFE 6323056 1709914 7433574 1480728 2204263 591 E: .22E0 Ident: 17/51 Ident% 33 Q: 944-994 (2346)   S: 7-55 (591) AICAR transformylase/IMP cyclohydrolase; Ade16p [Saccharomyces cerevisiae] BIFUNCTIONAL PURINE BIOSYNTHESIS PROTEIN ADE16 [INCLUDES: PHOSPHORIBOSYLAMINOIMIDAZOLECARBOXAMIDE FORMYLTRANSFERASE (AICAR TRANSFORMYLASE); IMP CYCLOHYDROLASE (INOSINICASE) (IMP SYNTHETASE) (ATIC)] BIFUNCTIONAL PURINE BIOSYNTHESIS PROTEIN ADE16 [INCLUDES: PHOSPHORIBOSYLAMINOIMIDAZOLECARBOXAMIDE FORMYLTRANSFERASE (AICAR TRANSFORMYLASE); IMP CYCLOHYDROLASE (INOSINICASE) (IMP SYNTHETASE) (ATIC)] BIFUNCTIONAL PURINE BIOSYNTHESIS PROTEIN ADE16 [INCLUDES: PHOSPHORIBOSYLAMINOIMIDAZOLECARBOXAMIDE FORMYLTRANSFERASE (AICAR TRANSFORMYLASE); IMP CYCLOHYDROLASE (INOSINICASE) (IMP SYNTHETASE) (ATIC)] BIFUNCTIONAL PURINE BIOSYNTHESIS PROTEIN ADE16 [INCLUDES: PHOSPHORIBOSYLAMINOIMIDAZOLECARBOXAMIDE FORMYLTRANSFERASE (AICAR TRANSFORMYLASE); IMP CYCLOHYDROLASE (INOSINICASE) (IMP SYNTHETASE) (ATIC)] phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3) - yeast (Saccharomyces cerevisiae) Pos: 29/51 Gap: 2/51 CPYXQ0WmFOZTmtYviTQ92Eg0+f0 15901135 14972759 1058 E: 0E0 Ident: 518/1061 Ident% 48 Q: 1-1058 (2346)   S: 1-1052 (1058) carbamoyl-phosphate synthase, large subunit [Streptococcus pneumoniae TIGR4] carbamoyl-phosphate synthase, large subunit [Streptococcus pneumoniae TIGR4] Pos: 721/1061 Gap: 12/1061 /iEAEDMs4ofk00Nv09N8NnAwRSM 15611920 7438083 4155424 1085 E: 0E0 Ident: 582/1101 Ident% 52 Q: 1-1073 (2346)   S: 1-1085 (1085) CARBAMOYL-PHOSPHATE SYNTHASE LARGE CHAIN [Helicobacter pylori J99] carbamoyl-phosphate synthase large chain - Helicobacter pylori (strain J99) CARBAMOYL-PHOSPHATE SYNTHASE LARGE CHAIN [Helicobacter pylori J99] Pos: 760/1101 Gap: 44/1101 WMBSpWl99YKrV62AyZ3xdG7tBhc 8134483 2547074 323 E: 2.8E0 Ident: 33/233 Ident% 14 Q: 640-869 (2346)   S: 98-316 (323) Glutathione synthetase (Glutathione synthase) (GSH synthetase) (GSH-S) (GSHASE) Glutathione synthetase (Glutathione synthase) (GSH synthetase) (GSH-S) (GSHASE) glutathione synthetase [Synechococcus sp.] Pos: 66/233 Gap: 17/233 9X18BRDPjmHrMqbJkEIpTYuzv1g 8249942 1102 E: 0E0 Ident: 595/1104 Ident% 53 Q: 1-1072 (2346)   S: 1-1096 (1102) carbamoylphosphate synthetase large chain [Streptomyces coelicolor A3(2)] Pos: 759/1104 Gap: 40/1104 Bwp78WXy91CpBBXEqmM7MQV7XJk 6323768 1709915 1084913 809579 592 E: .095E0 Ident: 16/51 Ident% 31 Q: 944-994 (2346)   S: 7-55 (592) AICAR transformylase/IMP cyclohydrolase; Ade17p [Saccharomyces cerevisiae] BIFUNCTIONAL PURINE BIOSYNTHESIS PROTEIN ADE17 [INCLUDES: PHOSPHORIBOSYLAMINOIMIDAZOLECARBOXAMIDE FORMYLTRANSFERASE (AICAR TRANSFORMYLASE); IMP CYCLOHYDROLASE (INOSINICASE) (IMP SYNTHETASE) (ATIC)] BIFUNCTIONAL PURINE BIOSYNTHESIS PROTEIN ADE17 [INCLUDES: PHOSPHORIBOSYLAMINOIMIDAZOLECARBOXAMIDE FORMYLTRANSFERASE (AICAR TRANSFORMYLASE); IMP CYCLOHYDROLASE (INOSINICASE) (IMP SYNTHETASE) (ATIC)] BIFUNCTIONAL PURINE BIOSYNTHESIS PROTEIN ADE17 [INCLUDES: PHOSPHORIBOSYLAMINOIMIDAZOLECARBOXAMIDE FORMYLTRANSFERASE (AICAR TRANSFORMYLASE); IMP CYCLOHYDROLASE (INOSINICASE) (IMP SYNTHETASE) (ATIC)] BIFUNCTIONAL PURINE BIOSYNTHESIS PROTEIN ADE17 [INCLUDES: PHOSPHORIBOSYLAMINOIMIDAZOLECARBOXAMIDE FORMYLTRANSFERASE (AICAR TRANSFORMYLASE); IMP CYCLOHYDROLASE (INOSINICASE) (IMP SYNTHETASE) (ATIC)] phosphoribosylaminoimidazolecarboxamide formyltransferase (EC 2.1.2.3) - yeast (Saccharomyces cerevisiae) Pos: 30/51 Gap: 2/51 JU64MJTtNfMoDtSMQP2c1KIM/GY 1711578 164669 417 E: 4.1E0 Ident: 9/50 Ident% 18 Q: 676-724 (2346)   S: 28-77 (417) SUCCINYL-COA LIGASE [GDP-FORMING] BETA-CHAIN, MITOCHONDRIAL PRECURSOR (SUCCINYL-COA SYNTHETASE, BETA CHAIN) (SCS-BETA) SUCCINYL-COA LIGASE [GDP-FORMING] BETA-CHAIN, MITOCHONDRIAL PRECURSOR (SUCCINYL-COA SYNTHETASE, BETA CHAIN) (SCS-BETA) succinyl-CoA synthetase beta-subunit [Sus scrofa] SUCCINYL-COA LIGASE [GDP-FORMING] BETA-CHAIN, MITOCHONDRIAL PRECURSOR (SUCCINYL-COA SYNTHETASE, BETA CHAIN) (SCS-BETA) SUCCINYL-COA LIGASE [GDP-FORMING] BETA-CHAIN, MITOCHONDRIAL PRECURSOR (SUCCINYL-COA SYNTHETASE, BETA CHAIN) (SCS-BETA) succinyl-CoA synthetase beta-subunit [Sus scrofa] Pos: 19/50 Gap: 1/50 R+tzrJ3qjPI3tLfmn09ppy+Nb4o 15645535 7438085 2314054 1085 E: 0E0 Ident: 585/1100 Ident% 53 Q: 1-1073 (2346)   S: 1-1085 (1085) carbamoyl-phosphate synthase (glutamine-hydrolysing) (pyrAb) [Helicobacter pylori 26695] carbamoyl-phosphate synthase (glutamine-hydrolyzing) (EC 6.3.5.5) large chain - Helicobacter pylori (strain 26695) carbamoyl-phosphate synthase (glutamine-hydrolysing) (pyrAb) [Helicobacter pylori 26695] Pos: 756/1100 Gap: 42/1100 OAFz1nQovRbK4W7vpGOU9QIDPpo 5821976 5821978 5821980 5821982 1073 E: 0E0 Ident: 1072/1073 Ident% 99 Q: 1-1073 (2346)   S: 1-1073 (1073) Chain A, Carbamoyl Phosphate Synthetase From Escherichis Coli With Complexed With The Allosteric Ligand Imp Chain C, Carbamoyl Phosphate Synthetase From Escherichis Coli With Complexed With The Allosteric Ligand Imp Chain E, Carbamoyl Phosphate Synthetase From Escherichis Coli With Complexed With The Allosteric Ligand Imp Chain G, Carbamoyl Phosphate Synthetase From Escherichis Coli With Complexed With The Allosteric Ligand Imp Pos: 1072/1073 Gap: -1/-1 +T8gjVdvIZ1XF/yiXdBFwPTeQdk 1709160 1073167 694121 390 E: 2.4E0 Ident: 9/70 Ident% 12 Q: 676-740 (2346)   S: 6-75 (390) MALATE--COA LIGASE BETA CHAIN (MALYL-COA SYNTHETASE) (MALATE THIOKINASE) (MTK-BETA) MALATE--COA LIGASE BETA CHAIN (MALYL-COA SYNTHETASE) (MALATE THIOKINASE) (MTK-BETA) MALATE--COA LIGASE BETA CHAIN (MALYL-COA SYNTHETASE) (MALATE THIOKINASE) (MTK-BETA) succinate--CoA ligase (ADP-forming) (EC 6.2.1.5) beta chain - Methylobacterium extorquens malate thiokinase [Methylobacterium extorquens] MALATE--COA LIGASE BETA CHAIN (MALYL-COA SYNTHETASE) (MALATE THIOKINASE) (MTK-BETA) MALATE--COA LIGASE BETA CHAIN (MALYL-COA SYNTHETASE) (MALATE THIOKINASE) (MTK-BETA) MALATE--COA LIGASE BETA CHAIN (MALYL-COA SYNTHETASE) (MALATE THIOKINASE) (MTK-BETA) succinate--CoA ligase (ADP-forming) (EC 6.2.1.5) beta chain - Methylobacterium extorquens malate thiokinase [Methylobacterium extorquens] Pos: 26/70 Gap: 5/70 OQar2xFRmTGLrw2OAHwwQ6kacP0 15611062 15840842 12229606 7438087 13881040 1115 E: 0E0 Ident: 578/1115 Ident% 51 Q: 1-1072 (2346)   S: 1-1110 (1115) Carbamoylphosphate synthase large subunit [Mycobacterium tuberculosis H37Rv] carbamoyl-phosphate synthase, large subunit [Mycobacterium tuberculosis CDC1551] Carbamoyl-phosphate synthase large chain (Carbamoyl-phosphate synthetase ammonia chain) Carbamoyl-phosphate synthase large chain (Carbamoyl-phosphate synthetase ammonia chain) carbamoyl-phosphate synthase (glutamine-hydrolyzing) (EC 6.3.5.5) large chain [similarity] - Mycobacterium tuberculosis (strain H37RV) carbamoyl-phosphate synthase, large subunit [Mycobacterium tuberculosis CDC1551] Pos: 738/1115 Gap: 48/1115 ZgBkewFrw69FvYYoba+q7mULYFg 15615099 10175156 1062 E: 0E0 Ident: 539/1061 Ident% 50 Q: 1-1057 (2346)   S: 1-1051 (1062) carbamoyl-phosphate synthetase (catalytic subunit) [Bacillus halodurans] carbamoyl-phosphate synthetase (catalytic subunit) [Bacillus halodurans] Pos: 734/1061 Gap: 14/1061 AH15B7L3rXCxT6OqOpfOfRAaPkA 173146 2214 E: 0E0 Ident: 449/1086 Ident% 41 Q: 3-1072 (2346)   S: 434-1505 (2214) carbamyl phosphate synthetase [Saccharomyces cerevisiae] Pos: 644/1086 Gap: 30/1086 fee+bWikIaOAYviuXygaykEq5Fg 18266638 342 E: .74E0 Ident: 38/261 Ident% 14 Q: 651-867 (2346)   S: 79-324 (342) putative inositol 1,3,4-trisphosphate 5/6-kinase [Oryza sativa] Pos: 68/261 Gap: 59/261 3KTELRyZwwGikdeLqCKplTJneF0 17986805 17982437 1162 E: 0E0 Ident: 688/1160 Ident% 59 Q: 1-1068 (2346)   S: 1-1159 (1162) CARBAMOYL-PHOSPHATE SYNTHASE LARGE CHAIN [Brucella melitensis] CARBAMOYL-PHOSPHATE SYNTHASE LARGE CHAIN [Brucella melitensis] Pos: 817/1160 Gap: 93/1160 GYjeTatNIMk4oAiGducb2DrSk9k 9955020 396 E: 4.7E0 Ident: 9/50 Ident% 18 Q: 676-724 (2346)   S: 7-56 (396) Chain B, Crystal Structure Of Dephosphorylated Pig Heart, Gtp- Specific Succinyl-Coa Synthetase Chain B, Crystal Structure Of Dephosphorylated Pig Heart, Gtp- Specific Succinyl-Coa Synthetase Chain B, Crystal Structure Of Dephosphorylated Pig Heart, Gtp- Specific Succinyl-Coa Synthetase Chain B, Crystal Structure Of Dephosphorylated Pig Heart, Gtp- Specific Succinyl-Coa Synthetase Pos: 19/50 Gap: 1/50 lU8tky0YPOVPbg6oy8Eit2SohzM 6322331 1172782 1070511 1008332 2214 E: 0E0 Ident: 449/1086 Ident% 41 Q: 3-1072 (2346)   S: 434-1505 (2214) First and second steps of pyrimidine biosynthesis; Ura2p [Saccharomyces cerevisiae] URA1 protein [Includes: Glutamine-dependent carbamoyl-phosphate synthase ; Aspartate carbamoyltransferase ] URA1 protein [Includes: Glutamine-dependent carbamoyl-phosphate synthase ; Aspartate carbamoyltransferase ] Pos: 644/1086 Gap: 30/1086 QF2onyU+sv0ZNtP7HN5rQYkuLZM 10640675 376 E: .008E0 Ident: 14/96 Ident% 14 Q: 679-766 (2346)   S: 20-111 (376) probable succinyl-CoA synthetase, beta subunit [Thermoplasma acidophilum] probable succinyl-CoA synthetase, beta subunit [Thermoplasma acidophilum] Pos: 37/96 Gap: 12/96 sHlZ+H+q/HLzf5yxURluKsr89k0 11272040 7981341 447 E: .47E0 Ident: 11/81 Ident% 13 Q: 676-744 (2346)   S: 42-122 (447) probable beta-succinyl CoA synthetase precursor [imported] - Neurospora crassa probable beta-succinyl CoA synthetase precursor [Neurospora crassa] probable beta-succinyl CoA synthetase precursor [imported] - Neurospora crassa probable beta-succinyl CoA synthetase precursor [Neurospora crassa] Pos: 27/81 Gap: 12/81 59y3Yj8WyqS6bbI/yxoemPeSWkA 17936061 17740645 1162 E: 0E0 Ident: 672/1161 Ident% 57 Q: 1-1068 (2346)   S: 1-1160 (1162) carbamoylphosphate synthase large subunit [Agrobacterium tumefaciens str. C58 (U. Washington)] carbamoylphosphate synthase large subunit [Agrobacterium tumefaciens str. C58 (U. Washington)] Pos: 809/1161 Gap: 94/1161 SZlA0lktbWyFwZDlt0sG05yyRTg 16127069 13424447 346 E: 5.9E0 Ident: 32/178 Ident% 17 Q: 495-658 (2346)   S: 112-280 (346) alcohol dehydrogenase, zinc-containing [Caulobacter crescentus] alcohol dehydrogenase, zinc-containing [Caulobacter crescentus] alcohol dehydrogenase, zinc-containing [Caulobacter crescentus] alcohol dehydrogenase, zinc-containing [Caulobacter crescentus] Pos: 56/178 Gap: 23/178 fkPPZXoLE0+C7PvAhMdfY8mIx8g 3766197 426 E: .007E0 Ident: 11/73 Ident% 15 Q: 676-736 (2346)   S: 21-93 (426) ATP-specific succinyl-CoA synthetase beta subunit [Homo sapiens] ATP-specific succinyl-CoA synthetase beta subunit [Homo sapiens] ATP-specific succinyl-CoA synthetase beta subunit [Homo sapiens] ATP-specific succinyl-CoA synthetase beta subunit [Homo sapiens] Pos: 27/73 Gap: 12/73 ik/jJAuswOXAunQ8eITE/AsZ5Os 7465686 3820584 1092 E: 0E0 Ident: 642/1114 Ident% 57 Q: 1-1070 (2346)   S: 1-1088 (1092) carbamoyl-phosphate synthase (glutamine-hydrolyzing) (EC 6.3.5.5) large chain carB - Zymomonas mobilis carbamoylphosphate synthetase large subunit [Zymomonas mobilis] Pos: 780/1114 Gap: 70/1114 YcPg1Havv/APgJxOvznKzwJZtzk 15805695 7471205 6458373 1024 E: 0E0 Ident: 588/1075 Ident% 54 Q: 1-1073 (2346)   S: 1-1024 (1024) carbamoyl-phosphate synthase, large subunit [Deinococcus radiodurans] carbamoyl-phosphate synthase, large subunit - Deinococcus radiodurans (strain R1) carbamoyl-phosphate synthase, large subunit [Deinococcus radiodurans] Pos: 723/1075 Gap: 53/1075 HqnxVOQACo0t/gBFwqr3J6xekxE 6980732 6980734 6980728 6980730 385 E: .003E0 Ident: 18/69 Ident% 26 Q: 676-739 (2346)   S: 6-74 (385) Chain B, Crystal Structure Of Dephosphorylated E. Coli Succinyl-Coa Synthetase Chain E, Crystal Structure Of Dephosphorylated E. Coli Succinyl-Coa Synthetase Chain B, Crystal Structure Of The Complex Of Adp And Mg2+ With Dephosphorylated E. Coli Succinyl-Coa Synthetase Chain E, Crystal Structure Of The Complex Of Adp And Mg2+ With Dephosphorylated E. Coli Succinyl-Coa Synthetase Chain B, Crystal Structure Of Dephosphorylated E. Coli Succinyl-Coa Synthetase Chain E, Crystal Structure Of Dephosphorylated E. Coli Succinyl-Coa Synthetase Chain B, Crystal Structure Of The Complex Of Adp And Mg2+ With Dephosphorylated E. Coli Succinyl-Coa Synthetase Chain E, Crystal Structure Of The Complex Of Adp And Mg2+ With Dephosphorylated E. Coli Succinyl-Coa Synthetase Pos: 29/69 Gap: 5/69 H/ZJu5vd5V9eQslDglk9S1yIUy8 16272827 1172763 1075151 1573904 532 E: .085E0 Ident: 19/55 Ident% 34 Q: 937-991 (2346)   S: 1-53 (532) phosphoribosylaminoimidazolecarboxamide formyltransferase (purH) [Haemophilus influenzae Rd] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] phosphoribosylaminoimidazolecarboxamide formyltransferase (purH) [Haemophilus influenzae Rd] Pos: 30/55 Gap: 2/55 R4ZWtRxZAMAaXRJsAI/1EUl7Wmc 16759060 16501350 1075 E: 0E0 Ident: 1052/1073 Ident% 98 Q: 1-1073 (2346)   S: 1-1073 (1075) carbamoyl-phosphate synthase large chain [Salmonella enterica subsp. enterica serovar Typhi] carbamoyl-phosphate synthase large chain [Salmonella enterica subsp. enterica serovar Typhi] Pos: 1062/1073 Gap: -1/-1 Mp5SJ5Du3vNuomzJSt6DJCBtpvA 131640 279479 154287 508 E: 5.4E0 Ident: 13/33 Ident% 39 Q: 959-991 (2346)   S: 1-33 (508) BIFUNCTIONAL PURINE BIOSYNTHESIS PROTEIN PURH [INCLUDES: PHOSPHORIBOSYLAMINOIMIDAZOLECARBOXAMIDE FORMYLTRANSFERASE (AICAR TRANSFORMYLASE); IMP CYCLOHYDROLASE (INOSINICASE) (IMP SYNTHETASE) (ATIC)] BIFUNCTIONAL PURINE BIOSYNTHESIS PROTEIN PURH [INCLUDES: PHOSPHORIBOSYLAMINOIMIDAZOLECARBOXAMIDE FORMYLTRANSFERASE (AICAR TRANSFORMYLASE); IMP CYCLOHYDROLASE (INOSINICASE) (IMP SYNTHETASE) (ATIC)] BIFUNCTIONAL PURINE BIOSYNTHESIS PROTEIN PURH [INCLUDES: PHOSPHORIBOSYLAMINOIMIDAZOLECARBOXAMIDE FORMYLTRANSFERASE (AICAR TRANSFORMYLASE); IMP CYCLOHYDROLASE (INOSINICASE) (IMP SYNTHETASE) (ATIC)] BIFUNCTIONAL PURINE BIOSYNTHESIS PROTEIN PURH [INCLUDES: PHOSPHORIBOSYLAMINOIMIDAZOLECARBOXAMIDE FORMYLTRANSFERASE (AICAR TRANSFORMYLASE); IMP CYCLOHYDROLASE (INOSINICASE) (IMP SYNTHETASE) (ATIC)] Pos: 18/33 Gap: -1/-1 q5iJsYxK3igIpaUcPC2R8ixoKeM 533532 1079 E: 0E0 Ident: 660/970 Ident% 68 Q: 1-969 (2346)   S: 1-966 (1079) carbamoyl phosphate synthetase (glutamine) large subunit [Neisseria gonorrhoeae] Pos: 767/970 Gap: 5/970 R+uOnabp5aKrNn7LPukyhFa+xWA 15894674 15024333 499 E: .04E0 Ident: 23/63 Ident% 36 Q: 941-1003 (2346)   S: 1-60 (499) AICAR transformylase/IMP cyclohydrolase [Clostridium acetobutylicum] AICAR transformylase/IMP cyclohydrolase [Clostridium acetobutylicum] Pos: 32/63 Gap: 3/63 6dCGl2XPEGUFpNzIYte1uK/BMgY 15615458 10175517 1047 E: 0E0 Ident: 451/1066 Ident% 42 Q: 1-1057 (2346)   S: 1-1034 (1047) arginine specific carbamoyl-phosphate synthase large chain; arginine specific carbamoyl-phosphate synthase subunit B [Bacillus halodurans] arginine specific carbamoyl-phosphate synthase large chain [Bacillus halodurans] Pos: 646/1066 Gap: 41/1066 I/FQp3c8ckxpxoyftKge2B5lDmI 11321583 7328935 463 E: .006E0 Ident: 11/73 Ident% 15 Q: 676-736 (2346)   S: 58-130 (463) succinate-CoA ligase, ADP-forming, beta subunit; SCS-betaA for ATP specific succinyl CoA synthetase beta subunit precursor [Homo sapiens] succinate-CoA ligase, ADP-forming, beta subunit; SCS-betaA for ATP specific succinyl CoA synthetase beta subunit precursor [Homo sapiens] succinate-CoA ligase, ADP-forming, beta subunit; SCS-betaA for ATP specific succinyl CoA synthetase beta subunit precursor [Homo sapiens] ATP specific succinyl CoA synthetase beta subunit precursor [Homo sapiens] ATP specific succinyl CoA synthetase beta subunit precursor [Homo sapiens] succinate-CoA ligase, ADP-forming, beta subunit; SCS-betaA for ATP specific succinyl CoA synthetase beta subunit precursor [Homo sapiens] succinate-CoA ligase, ADP-forming, beta subunit; SCS-betaA for ATP specific succinyl CoA synthetase beta subunit precursor [Homo sapiens] succinate-CoA ligase, ADP-forming, beta subunit; SCS-betaA for ATP specific succinyl CoA synthetase beta subunit precursor [Homo sapiens] ATP specific succinyl CoA synthetase beta subunit precursor [Homo sapiens] ATP specific succinyl CoA synthetase beta subunit precursor [Homo sapiens] Pos: 27/73 Gap: 12/73 pH3xaXXYxn4ESZehNYiwS5sK1U4 17937842 16271965 17742601 348 E: .049E0 Ident: 20/122 Ident% 16 Q: 66-187 (2346)   S: 86-191 (348) glutathione synthetase [Agrobacterium tumefaciens str. C58 (U. Washington)] glutathione synthetase [Agrobacterium tumefaciens str. C58 (U. Washington)] glutathione synthetase [Agrobacterium tumefaciens str. C58 (U. Washington)] glutathione synthetase [Agrobacterium tumefaciens str. C58 (U. Washington)] Pos: 41/122 Gap: 16/122 4XaWAa9L1XNCGiJcT20Ugd7luMc 16124341 13421187 529 E: .059E0 Ident: 24/60 Ident% 40 Q: 944-1003 (2346)   S: 18-74 (529) phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Caulobacter crescentus] phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Caulobacter crescentus] phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Caulobacter crescentus] phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Caulobacter crescentus] Pos: 32/60 Gap: 3/60 /3dg4q5WrXdeS4e85eam5BB5UmA 10580499 542 E: .39E0 Ident: 31/231 Ident% 13 Q: 53-224 (2346)   S: 204-434 (542) acetyl-CoA synthetase; Acs3 [Halobacterium sp. NRC-1] acetyl-CoA synthetase; Acs3 [Halobacterium sp. NRC-1] Pos: 64/231 Gap: 59/231 KEhAqjiMaTCJjwb96o9c6HKbjM4 14278285 14278286 593 E: .41E0 Ident: 20/47 Ident% 42 Q: 945-991 (2346)   S: 8-52 (593) Chain A, Crystal Structure Of Avian Atic, A Bifunctional Transformylase And Cyclohydrolase Enzyme In Purine Biosynthesis At 1.75 Ang. Resolution Chain A, Crystal Structure Of Avian Atic, A Bifunctional Transformylase And Cyclohydrolase Enzyme In Purine Biosynthesis At 1.75 Ang. Resolution Chain B, Crystal Structure Of Avian Atic, A Bifunctional Transformylase And Cyclohydrolase Enzyme In Purine Biosynthesis At 1.75 Ang. Resolution Chain B, Crystal Structure Of Avian Atic, A Bifunctional Transformylase And Cyclohydrolase Enzyme In Purine Biosynthesis At 1.75 Ang. Resolution Pos: 26/47 Gap: 2/47 xh8JuoZXOLpu12zSGiGbDfYmnqw 15924235 15926828 13701045 14247015 388 E: .093E0 Ident: 16/67 Ident% 23 Q: 679-740 (2346)   S: 9-75 (388) succinyl-CoA synthetase [Staphylococcus aureus subsp. aureus Mu50] succinyl-CoA synthetase [Staphylococcus aureus subsp. aureus N315] succinyl-CoA synthetase [Staphylococcus aureus subsp. aureus N315] succinyl-CoA synthetase [Staphylococcus aureus subsp. aureus Mu50] succinyl-CoA synthetase [Staphylococcus aureus subsp. aureus Mu50] succinyl-CoA synthetase [Staphylococcus aureus subsp. aureus N315] succinyl-CoA synthetase [Staphylococcus aureus subsp. aureus N315] succinyl-CoA synthetase [Staphylococcus aureus subsp. aureus Mu50] Pos: 28/67 Gap: 5/67 fb1j5LOZZ/plqTGK6e1NhsKWoM8 3115302 86 E: .62E0 Ident: 4/30 Ident% 13 Q: 4-33 (2346)   S: 57-86 (86) Acetyl-CoA carboxylase [Ovis aries] Pos: 8/30 Gap: -1/-1 IQ9tITKbJAz70cbF/PyXZI9w2HE 15791649 11272713 6967755 1089 E: 0E0 Ident: 602/1098 Ident% 54 Q: 1-1073 (2346)   S: 1-1088 (1089) carbamoyl-phosphate synthase large chain [Campylobacter jejuni] carbamoyl-phosphate synthase (glutamine-hydrolyzing) (EC 6.3.5.5) large chain Cj0279 [imported] - Campylobacter jejuni (strain NCTC 11168) carbamoyl-phosphate synthase large chain [Campylobacter jejuni] Pos: 778/1098 Gap: 35/1098 S6jAoW1jFo937A812qKHTo1f+qI 12848590 570 E: .073E0 Ident: 20/56 Ident% 35 Q: 939-994 (2346)   S: 1-54 (570) 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase~data source:MGD, source key:MGI:1351352, evidence:ISS~putative [Mus musculus] 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase~data source:MGD, source key:MGI:1351352, evidence:ISS~putative [Mus musculus] Pos: 29/56 Gap: 2/56 bawelEkLYzgBap7HYeMqVDFWOhw 3915831 2144531 2236 E: 0E0 Ident: 350/1060 Ident% 33 Q: 17-1055 (2346)   S: 418-1459 (2236) CAD PROTEIN (RUDIMENTARY PROTEIN) [INCLUDES: GLUTAMINE-DEPENDENT CARBAMOYL-PHOSPHATE SYNTHASE ; ASPARTATE CARBAMOYLTRANSFERASE ; DIHYDROOROTASE ] CAD PROTEIN (RUDIMENTARY PROTEIN) [INCLUDES: GLUTAMINE-DEPENDENT CARBAMOYL-PHOSPHATE SYNTHASE ; ASPARTATE CARBAMOYLTRANSFERASE ; DIHYDROOROTASE ] Pos: 531/1060 Gap: 39/1060 5pnbjv5HQvZlGIliY2Df5A/pWuY 15838569 11257035 9107081 574 E: .024E0 Ident: 26/60 Ident% 43 Q: 944-1003 (2346)   S: 57-113 (574) bifunctional purine biosynthesis protein [Xylella fastidiosa 9a5c] bifunctional purine biosynthesis protein XF1975 [imported] - Xylella fastidiosa (strain 9a5c) bifunctional purine biosynthesis protein [Xylella fastidiosa 9a5c] Pos: 35/60 Gap: 3/60 I814cyArxzLBYANsVIII/3gZKlM 16800221 16413611 183 E: 6.9E0 Ident: 13/76 Ident% 17 Q: 436-507 (2346)   S: 86-156 (183) similar to transcriptional regulator [Listeria innocua] similar to transcriptional regulator [Listeria innocua] similar to transcriptional regulator [Listeria innocua] similar to transcriptional regulator [Listeria innocua] Pos: 30/76 Gap: 9/76 GpEvzyiN5RVRJndVSZsPQghnrJ4 15804597 15834183 12518938 13364405 529 E: .029E0 Ident: 22/48 Ident% 45 Q: 944-991 (2346)   S: 9-54 (529) phosphoribosylaminoimidazolecarboxamide formyltransferase = AICAR formyltransferase; IMP cyclohydrolase [Escherichia coli O157:H7 EDL933] phosphoribosylaminoimidazolecarboxamide formyltransferase = AICAR formyltransferase; IMP cyclohydrolase [Escherichia coli O157:H7 EDL933] phosphoribosylaminoimidazolecarboxamide formyltransferase = AICAR formyltransferase; IMP cyclohydrolase [Escherichia coli O157:H7 EDL933] phosphoribosylaminoimidazolecarboxamide formyltransferase = AICAR formyltransferase; IMP cyclohydrolase [Escherichia coli O157:H7 EDL933] Pos: 28/48 Gap: 2/48 SjsoURYZS6DM3GrYCVO5naOfah8 16273116 1174473 1075329 1574125 389 E: 4.4E0 Ident: 34/202 Ident% 16 Q: 676-844 (2346)   S: 6-200 (389) succinyl-CoA synthetase, beta subunit (sucC) [Haemophilus influenzae Rd] Succinyl-CoA synthetase beta chain (SCS-beta) succinate--CoA ligase (ADP-forming) (EC 6.2.1.5) beta chain - Haemophilus influenzae (strain Rd KW20) succinyl-CoA synthetase, beta subunit (sucC) [Haemophilus influenzae Rd] succinyl-CoA synthetase, beta subunit (sucC) [Haemophilus influenzae Rd] Succinyl-CoA synthetase beta chain (SCS-beta) succinate--CoA ligase (ADP-forming) (EC 6.2.1.5) beta chain - Haemophilus influenzae (strain Rd KW20) succinyl-CoA synthetase, beta subunit (sucC) [Haemophilus influenzae Rd] Pos: 60/202 Gap: 40/202 MOYX/DMsdH9fzEcqq40tfswLEds 17936698 17741343 538 E: .072E0 Ident: 32/100 Ident% 32 Q: 931-1026 (2346)   S: 2-94 (538) bifunctional purine biosynthesis protein [Agrobacterium tumefaciens str. C58 (U. Washington)] bifunctional purine biosynthesis protein [Agrobacterium tumefaciens str. C58 (U. Washington)] Pos: 41/100 Gap: 11/100 YnxujMNEnZd2Nu9XEqxiijYYLw0 18311554 18146238 1067 E: 0E0 Ident: 508/1069 Ident% 47 Q: 1-1065 (2346)   S: 1-1063 (1067) carbamoyl-phosphate synthetase catalytic subunit [Clostridium perfringens] carbamoyl-phosphate synthetase catalytic subunit [Clostridium perfringens] Pos: 714/1069 Gap: 10/1069 brgjUfmPasX9RGGNfNYNvYljjfg 8218215 523 E: .066E0 Ident: 20/60 Ident% 33 Q: 935-994 (2346)   S: 5-62 (523) bifunctional purine biosynthesis protein [Streptomyces coelicolor A3(2)] Pos: 31/60 Gap: 2/60 HDoheQ+5Ne/3QJtAzEQoJookijQ 16123429 15981206 880 E: 2.2E0 Ident: 17/132 Ident% 12 Q: 681-799 (2346)   S: 489-620 (880) putative acetyltransferase [Yersinia pestis] putative acetyltransferase [Yersinia pestis] putative acetyltransferase [Yersinia pestis] putative acetyltransferase [Yersinia pestis] Pos: 39/132 Gap: 13/132 GswBeXIPsMquVaxf4YpKVvjayWM 2120363 881495 128 E: 1.6E0 Ident: 21/135 Ident% 15 Q: 16-150 (2346)   S: 18-126 (128) D-alanylalanine ligase homolog - Thermotoga maritima (fragment) Pos: 43/135 Gap: 26/135 iYFKLDJTGpOLhph93bcMFxVa414 15608097 15840381 7994674 7433575 1524205 13880548 523 E: .018E0 Ident: 22/60 Ident% 36 Q: 944-1003 (2346)   S: 12-68 (523) phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Mycobacterium tuberculosis CDC1551] phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Mycobacterium tuberculosis CDC1551] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Mycobacterium tuberculosis CDC1551] phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Mycobacterium tuberculosis CDC1551] Pos: 32/60 Gap: 3/60 L7xjZh7ND3NaL3C4DGXwiv+7GrI 16081856 10640070 1047 E: 0E0 Ident: 459/1079 Ident% 42 Q: 1-1073 (2346)   S: 1-1045 (1047) probable carbamoyl-phosphate synthase, large subunit [Thermoplasma acidophilum] probable carbamoyl-phosphate synthase, large subunit [Thermoplasma acidophilum] Pos: 660/1079 Gap: 40/1079 +HVZAeDxi6SpaeSoP+vA9iC93no 16124396 13421252 317 E: 2.6E0 Ident: 9/69 Ident% 13 Q: 143-211 (2346)   S: 136-203 (317) glutathione synthetase [Caulobacter crescentus] glutathione synthetase [Caulobacter crescentus] glutathione synthetase [Caulobacter crescentus] glutathione synthetase [Caulobacter crescentus] Pos: 23/69 Gap: 1/69 F7QFFgcuJLIyrkQr609wSJ1b4mM 6322569 115631 68662 171310 1015822 1118 E: 0E0 Ident: 411/1086 Ident% 37 Q: 7-1072 (2346)   S: 28-1101 (1118) carbamyl phosphate synthetase; Cpa2p [Saccharomyces cerevisiae] CARBAMOYL-PHOSPHATE SYNTHASE, ARGININE-SPECIFIC, LARGE CHAIN (ARGININE-SPECIFIC CARBAMOYL-PHOSPHATE SYNTHETASE, AMMONIA CHAIN) CARBAMOYL-PHOSPHATE SYNTHASE, ARGININE-SPECIFIC, LARGE CHAIN (ARGININE-SPECIFIC CARBAMOYL-PHOSPHATE SYNTHETASE, AMMONIA CHAIN) carbamoyl-phosphate synthase (glutamine-hydrolyzing) (EC 6.3.5.5) arginine-specific large chain - yeast (Saccharomyces cerevisiae) carbamyl phosphate synthetase large subunit [Saccharomyces cerevisiae] Pos: 624/1086 Gap: 32/1086 edIl9fnZ7VVwLd5yLDSYU7hQl5I 15596785 12230960 11352604 9947552 388 E: .002E0 Ident: 15/67 Ident% 22 Q: 679-740 (2346)   S: 9-75 (388) succinyl-CoA synthetase beta chain [Pseudomonas aeruginosa] Succinyl-CoA synthetase beta chain (SCS-beta) succinyl-CoA synthetase beta chain PA1588 [imported] - Pseudomonas aeruginosa (strain PAO1) succinyl-CoA synthetase beta chain [Pseudomonas aeruginosa] succinyl-CoA synthetase beta chain [Pseudomonas aeruginosa] Succinyl-CoA synthetase beta chain (SCS-beta) succinyl-CoA synthetase beta chain PA1588 [imported] - Pseudomonas aeruginosa (strain PAO1) succinyl-CoA synthetase beta chain [Pseudomonas aeruginosa] Pos: 24/67 Gap: 5/67 gG5hJKE8rpN22yyPt+k0iIrYytI 400901 279480 238786 593 E: .44E0 Ident: 20/47 Ident% 42 Q: 945-991 (2346)   S: 8-52 (593) BIFUNCTIONAL PURINE BIOSYNTHESIS PROTEIN PURH [INCLUDES: PHOSPHORIBOSYLAMINOIMIDAZOLECARBOXAMIDE FORMYLTRANSFERASE (AICAR TRANSFORMYLASE); IMP CYCLOHYDROLASE (INOSINICASE) (IMP SYNTHETASE) (ATIC)] BIFUNCTIONAL PURINE BIOSYNTHESIS PROTEIN PURH [INCLUDES: PHOSPHORIBOSYLAMINOIMIDAZOLECARBOXAMIDE FORMYLTRANSFERASE (AICAR TRANSFORMYLASE); IMP CYCLOHYDROLASE (INOSINICASE) (IMP SYNTHETASE) (ATIC)] BIFUNCTIONAL PURINE BIOSYNTHESIS PROTEIN PURH [INCLUDES: PHOSPHORIBOSYLAMINOIMIDAZOLECARBOXAMIDE FORMYLTRANSFERASE (AICAR TRANSFORMYLASE); IMP CYCLOHYDROLASE (INOSINICASE) (IMP SYNTHETASE) (ATIC)] BIFUNCTIONAL PURINE BIOSYNTHESIS PROTEIN PURH [INCLUDES: PHOSPHORIBOSYLAMINOIMIDAZOLECARBOXAMIDE FORMYLTRANSFERASE (AICAR TRANSFORMYLASE); IMP CYCLOHYDROLASE (INOSINICASE) (IMP SYNTHETASE) (ATIC)] 5-aminoimidazole-4-carboxamide-ribonucleotide transformylase-IMP cyclohydrolase; ATIC [Gallus gallus] Pos: 26/47 Gap: 2/47 l/RzabCD1P/dEo/AmaYoXpYV1FY 16120812 15978576 1077 E: 0E0 Ident: 994/1073 Ident% 92 Q: 1-1073 (2346)   S: 1-1073 (1077) carbamoyl-phosphate synthase large chain [Yersinia pestis] carbamoyl-phosphate synthase large chain [Yersinia pestis] Pos: 1036/1073 Gap: -1/-1 S0ghFaKUX3ILASG7bFYmFrreyN0 11878280 612 E: .019E0 Ident: 17/72 Ident% 23 Q: 929-994 (2346)   S: 69-138 (612) phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Nicotiana tabacum] phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Nicotiana tabacum] Pos: 31/72 Gap: 8/72 SWKHB4GFDcC3CH2XeqIsFFAlZhI 16554478 700 E: .2E0 Ident: 31/231 Ident% 13 Q: 53-224 (2346)   S: 362-592 (700) Acetyl-CoA synthetase [Halobacterium sp. NRC-1] Acetyl-CoA synthetase [Halobacterium sp. NRC-1] Pos: 64/231 Gap: 59/231 gt9MA7atCwewerbjejwOG4/wz+E 15644005 7994676 7462921 4981804 452 E: .2E0 Ident: 18/51 Ident% 35 Q: 944-994 (2346)   S: 3-51 (452) phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Thermotoga maritima] phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Thermotoga maritima] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] phosphoribosylaminoimidazolecarboxamide formyltransferase/ IMP cyclohydrolase - Thermotoga maritima (strain MSB8) phosphoribosylaminoimidazolecarboxamide formyltransferase/ IMP cyclohydrolase - Thermotoga maritima (strain MSB8) phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Thermotoga maritima] phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Thermotoga maritima] Pos: 31/51 Gap: 2/51 KBTK9HDcxTcTw603FGkVTq4qOiA 15214215 12846177 592 E: .078E0 Ident: 20/56 Ident% 35 Q: 939-994 (2346)   S: 1-54 (592) Bifunctional purine biosynthesis protein PURH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein PURH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein PURH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein PURH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase~data source:MGD, source key:MGI:1351352, evidence:ISS~putative [Mus musculus] 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase~data source:MGD, source key:MGI:1351352, evidence:ISS~putative [Mus musculus] Pos: 29/56 Gap: 2/56 M/IFzhW22I58AwS+edjKrqmZuo8 2500031 1514603 1058 E: 0E0 Ident: 514/1059 Ident% 48 Q: 1-1056 (2346)   S: 1-1050 (1058) CARBAMOYL-PHOSPHATE SYNTHASE, PYRIMIDINE-SPECIFIC, LARGE CHAIN (CARBAMOYL-PHOSPHATE SYNTHETASE AMMONIA CHAIN) CARBAMOYL-PHOSPHATE SYNTHASE, PYRIMIDINE-SPECIFIC, LARGE CHAIN (CARBAMOYL-PHOSPHATE SYNTHETASE AMMONIA CHAIN) carbamoyl-phosphate synthase [Lactobacillus plantarum] Pos: 703/1059 Gap: 12/1059 hIySKsfJP+p3cB7eXNXdQb5O164 17545223 17427514 524 E: .005E0 Ident: 21/48 Ident% 43 Q: 945-992 (2346)   S: 5-50 (524) PROBABLE BIFUNCTIONAL : PHOSPHORIBOSYLAMINOIMIDAZOLECARBOXAMIDE FORMYLTRANSFERASE AND IMP CYCLOHYDROLASE TRANSMEMBRANE PROTEIN [Ralstonia solanacearum] PROBABLE BIFUNCTIONAL : PHOSPHORIBOSYLAMINOIMIDAZOLECARBOXAMIDE FORMYLTRANSFERASE AND IMP CYCLOHYDROLASE TRANSMEMBRANE PROTEIN [Ralstonia solanacearum] PROBABLE BIFUNCTIONAL : PHOSPHORIBOSYLAMINOIMIDAZOLECARBOXAMIDE FORMYLTRANSFERASE AND IMP CYCLOHYDROLASE TRANSMEMBRANE PROTEIN [Ralstonia solanacearum] PROBABLE BIFUNCTIONAL : PHOSPHORIBOSYLAMINOIMIDAZOLECARBOXAMIDE FORMYLTRANSFERASE AND IMP CYCLOHYDROLASE TRANSMEMBRANE PROTEIN [Ralstonia solanacearum] Pos: 27/48 Gap: 2/48 6njbokd1VDvLKKZqyzy8940fJeY 15799715 15829290 12512719 13359492 1073 E: 0E0 Ident: 1070/1073 Ident% 99 Q: 1-1073 (2346)   S: 1-1073 (1073) carbamoyl-phosphate synthase large subunit [Escherichia coli O157:H7 EDL933] carbamoyl-phosphate synthase large subunit [Escherichia coli O157:H7] carbamoyl-phosphate synthase large subunit [Escherichia coli O157:H7 EDL933] carbamoyl-phosphate synthase large subunit [Escherichia coli O157:H7] Pos: 1073/1073 Gap: -1/-1 fIrQPyMaQvukYXGJuE+De1N00yA 16330125 8134484 7437931 1652612 320 E: 2E0 Ident: 33/196 Ident% 16 Q: 650-843 (2346)   S: 108-290 (320) glutathione synthetase [Synechocystis sp. PCC 6803] Glutathione synthetase (Glutathione synthase) (GSH synthetase) (GSH-S) (GSHASE) Glutathione synthetase (Glutathione synthase) (GSH synthetase) (GSH-S) (GSHASE) glutathione synthase (EC 6.3.2.3) - Synechocystis sp. (strain PCC 6803) glutathione synthetase [Synechocystis sp. PCC 6803] Pos: 58/196 Gap: 15/196 Ze51HC4wmEDP7J0JIqkxGVyOFhk 2507278 1750392 1075 E: 0E0 Ident: 1053/1073 Ident% 98 Q: 1-1073 (2346)   S: 1-1073 (1075) CARBAMOYL-PHOSPHATE SYNTHASE LARGE CHAIN (CARBAMOYL-PHOSPHATE SYNTHETASE AMMONIA CHAIN) CARBAMOYL-PHOSPHATE SYNTHASE LARGE CHAIN (CARBAMOYL-PHOSPHATE SYNTHETASE AMMONIA CHAIN) carbamoylphosphate synthetase large subunit [Salmonella typhimurium] Pos: 1063/1073 Gap: -1/-1 x3MIMvvMRzDK9tsqWlQu7kPVXkc 3766201 426 E: .022E0 Ident: 11/73 Ident% 15 Q: 676-736 (2346)   S: 21-93 (426) ATP-specific succinyl-CoA synthetase beta subunit [Mus musculus] ATP-specific succinyl-CoA synthetase beta subunit [Mus musculus] ATP-specific succinyl-CoA synthetase beta subunit [Mus musculus] ATP-specific succinyl-CoA synthetase beta subunit [Mus musculus] Pos: 27/73 Gap: 12/73 PLohKgeEeghyxJHkBvpr0jSL2Rw 15643323 7438082 4981072 1099 E: 0E0 Ident: 593/1106 Ident% 53 Q: 1-1068 (2346)   S: 1-1093 (1099) carbamoyl-phosphate synthase, large subunit [Thermotoga maritima] carbamoyl-phosphate synthase (glutamine-hydrolyzing) (EC 6.3.5.5) large chain [similarity] - Thermotoga maritima (strain MSB8) carbamoyl-phosphate synthase, large subunit [Thermotoga maritima] Pos: 764/1106 Gap: 51/1106 RG6Vy2PD1GxyzUXsPgB5HotReL8 15676875 11257048 7226223 526 E: .001E0 Ident: 27/106 Ident% 25 Q: 939-1016 (2346)   S: 1-104 (526) phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Neisseria meningitidis MC58] phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Neisseria meningitidis MC58] phosphoribosylaminoimidazolecarboxamide formyltransferase/ IMP cyclohydrolase NMB0983 [imported] - Neisseria meningitidis (group B strain MD58) phosphoribosylaminoimidazolecarboxamide formyltransferase/ IMP cyclohydrolase NMB0983 [imported] - Neisseria meningitidis (group B strain MD58) phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Neisseria meningitidis MC58] phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Neisseria meningitidis MC58] Pos: 41/106 Gap: 30/106 3JBJzGwkrxDfSkqIckmaWb4bobI 15805894 7473335 6458585 523 E: .11E0 Ident: 28/63 Ident% 44 Q: 941-1003 (2346)   S: 14-73 (523) phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Deinococcus radiodurans] phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Deinococcus radiodurans] phosphoribosylaminoimidazolecarboxamide formyltransferase/ IMP cyclohydrolase - Deinococcus radiodurans (strain R1) phosphoribosylaminoimidazolecarboxamide formyltransferase/ IMP cyclohydrolase - Deinococcus radiodurans (strain R1) phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Deinococcus radiodurans] phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Deinococcus radiodurans] Pos: 37/63 Gap: 3/63 l7x3OduSX4h4v5F3UbrQEQRUZBE 539732 417 E: 4.1E0 Ident: 9/50 Ident% 18 Q: 676-724 (2346)   S: 28-77 (417) succinate--CoA ligase (GDP-forming) (EC 6.2.1.4) beta chain precursor - pig succinate--CoA ligase (GDP-forming) (EC 6.2.1.4) beta chain precursor - pig Pos: 19/50 Gap: 1/50 4xvG3n9aA0G8LaKoj0i0npKMTnU 16759677 16764108 16419248 16501970 388 E: .002E0 Ident: 17/69 Ident% 24 Q: 676-739 (2346)   S: 6-74 (388) succinyl-CoA synthetase beta chain [Salmonella enterica subsp. enterica serovar Typhi] succinyl-CoA synthetase, beta subunit [Salmonella typhimurium LT2] succinyl-CoA synthetase, beta subunit [Salmonella typhimurium LT2] succinyl-CoA synthetase beta chain [Salmonella enterica subsp. enterica serovar Typhi] succinyl-CoA synthetase beta chain [Salmonella enterica subsp. enterica serovar Typhi] succinyl-CoA synthetase, beta subunit [Salmonella typhimurium LT2] succinyl-CoA synthetase, beta subunit [Salmonella typhimurium LT2] succinyl-CoA synthetase beta chain [Salmonella enterica subsp. enterica serovar Typhi] Pos: 29/69 Gap: 5/69 7ZWzOz0zplc2c1pbwsXO6sV5ijQ 15618881 15836505 16752058 7437902 4377299 7189799 8979346 386 E: .37E0 Ident: 9/50 Ident% 18 Q: 676-724 (2346)   S: 6-55 (386) Succinyl-CoA Synthetase, Beta [Chlamydophila pneumoniae CWL029] succinyl-CoA synthetase, beta [Chlamydophila pneumoniae J138] succinyl-CoA synthetase, beta subunit [Chlamydophila pneumoniae AR39] succinyl-CoA synthetase, beta chain CP0886 [imported] - Chlamydophila pneumoniae (strains CWL029 and AR39) Succinyl-CoA Synthetase, Beta [Chlamydophila pneumoniae CWL029] succinyl-CoA synthetase, beta subunit [Chlamydophila pneumoniae AR39] succinyl-CoA synthetase, beta [Chlamydophila pneumoniae J138] Succinyl-CoA Synthetase, Beta [Chlamydophila pneumoniae CWL029] succinyl-CoA synthetase, beta [Chlamydophila pneumoniae J138] succinyl-CoA synthetase, beta subunit [Chlamydophila pneumoniae AR39] succinyl-CoA synthetase, beta chain CP0886 [imported] - Chlamydophila pneumoniae (strains CWL029 and AR39) Succinyl-CoA Synthetase, Beta [Chlamydophila pneumoniae CWL029] succinyl-CoA synthetase, beta subunit [Chlamydophila pneumoniae AR39] succinyl-CoA synthetase, beta [Chlamydophila pneumoniae J138] Pos: 17/50 Gap: 1/50 my6t0EB3z6is28E/7M9rvTfgq0U 13472276 14023021 1167 E: 0E0 Ident: 681/1167 Ident% 58 Q: 1-1068 (2346)   S: 1-1165 (1167) carbamoyl-phosphate synthase large subunit [Mesorhizobium loti] carbamoyl-phosphate synthase large subunit [Mesorhizobium loti] Pos: 817/1167 Gap: 101/1167 m4KsTWaq20jSPiX9BlRKEJGap7Y 14601167 7437898 5104735 405 E: .38E0 Ident: 14/90 Ident% 15 Q: 678-757 (2346)   S: 35-124 (405) succinyl-CoA synthetase beta chain [Aeropyrum pernix] probable succinyl-CoA synthetase beta chain APE1065 - Aeropyrum pernix (strain K1) 405aa long hypothetical succinyl-CoA synthetase beta chain [Aeropyrum pernix] succinyl-CoA synthetase beta chain [Aeropyrum pernix] probable succinyl-CoA synthetase beta chain APE1065 - Aeropyrum pernix (strain K1) 405aa long hypothetical succinyl-CoA synthetase beta chain [Aeropyrum pernix] Pos: 34/90 Gap: 10/90 9GG6wrlTX6gjnVRMtkZuyB6Zh3Y 16077720 131638 66485 143373 2632966 512 E: .001E0 Ident: 22/60 Ident% 36 Q: 944-1003 (2346)   S: 5-61 (512) phosphoribosylaminoimidazole carboxy formyl formyltransferase; inosine-monophosphate cyclohydrolase [Bacillus subtilis] phosphoribosylaminoimidazole carboxy formyl formyltransferase; inosine-monophosphate cyclohydrolase [Bacillus subtilis] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] phosphoribosyl aminoimidazole carboxy formyl formyltransferase/inosine monophosphate cyclohydrolase (PUR-H(J)) [Bacillus subtilis] phosphoribosyl aminoimidazole carboxy formyl formyltransferase/inosine monophosphate cyclohydrolase (PUR-H(J)) [Bacillus subtilis] inosine-monophosphate cyclohydrolase; phosphoribosylaminoimidazole carboxy formyl formyltransferase [Bacillus subtilis] inosine-monophosphate cyclohydrolase; phosphoribosylaminoimidazole carboxy formyl formyltransferase [Bacillus subtilis] Pos: 34/60 Gap: 3/60 ycdaR2SOz+LKafnXmHxrVJVo8ik 15902095 15457583 522 E: .11E0 Ident: 25/101 Ident% 24 Q: 941-1041 (2346)   S: 8-102 (522) Phosphoribosylaminoimidazolecarboxamide formyltransferase [Streptococcus pneumoniae R6] Phosphoribosylaminoimidazolecarboxamide formyltransferase [Streptococcus pneumoniae R6] Pos: 42/101 Gap: 6/101 gqVxLkxt3rZ3Ggv2EARFjTgJ8Tk 2624396 125 E: .4E0 Ident: 11/83 Ident% 13 Q: 676-743 (2346)   S: 6-88 (125) succinyl-CoA synthetase beta sub-unit [Rhizobium leguminosarum] succinyl-CoA synthetase beta sub-unit [Rhizobium leguminosarum] Pos: 26/83 Gap: 15/83 t6HwqE/C8b7MY8nIvORCNsxYU+E 15599950 12644249 11347531 1750387 9951019 1073 E: 0E0 Ident: 819/1073 Ident% 76 Q: 1-1073 (2346)   S: 1-1072 (1073) carbamoylphosphate synthetase large subunit [Pseudomonas aeruginosa] CARBAMOYL-PHOSPHATE SYNTHASE LARGE CHAIN (CARBAMOYL-PHOSPHATE SYNTHETASE AMMONIA CHAIN) CARBAMOYL-PHOSPHATE SYNTHASE LARGE CHAIN (CARBAMOYL-PHOSPHATE SYNTHETASE AMMONIA CHAIN) carbamoylphosphate synthetase large subunit PA4756 [imported] - Pseudomonas aeruginosa (strain PAO1) carbamoylphosphate synthetase large subunit [Pseudomonas aeruginosa] carbamoylphosphate synthetase large subunit [Pseudomonas aeruginosa] Pos: 919/1073 Gap: 1/1073 97xxOPmSbhgbUDAEaCdrds0nw6c 17546240 17428537 1081 E: 0E0 Ident: 745/1087 Ident% 68 Q: 1-1072 (2346)   S: 1-1081 (1081) PROBABLE CARBAMOYL-PHOSPHATE SYNTHASE (LARGE CHAIN) PROTEIN [Ralstonia solanacearum] PROBABLE CARBAMOYL-PHOSPHATE SYNTHASE (LARGE CHAIN) PROTEIN [Ralstonia solanacearum] Pos: 863/1087 Gap: 21/1087 h4x/czpGbSAiLopdtkBEb3ebdGg 102216 7245 1042 E: 0E0 Ident: 414/1060 Ident% 39 Q: 9-1053 (2346)   S: 1-1042 (1042) glutamine-dependent carbamyl phosphate synthetase [Dictyostelium discoideum] Pos: 617/1060 Gap: 33/1060 YrUlwzP8v0m2E6svKNXhtyDsDME 9663622 160 E: .041E0 Ident: 11/74 Ident% 14 Q: 150-216 (2346)   S: 4-77 (160) possible putative carboxylase. [Leishmania major] possible putative carboxylase. [Leishmania major] Pos: 28/74 Gap: 7/74 zbGCIJRqdSn0W9jAe1z3lulll04 15596214 11350799 9946928 715 E: .013E0 Ident: 12/38 Ident% 31 Q: 678-715 (2346)   S: 497-534 (715) pimeloyl-CoA synthetase [Pseudomonas aeruginosa] pimeloyl-CoA synthetase PA1017 [imported] - Pseudomonas aeruginosa (strain PAO1) pimeloyl-CoA synthetase [Pseudomonas aeruginosa] pimeloyl-CoA synthetase [Pseudomonas aeruginosa] pimeloyl-CoA synthetase PA1017 [imported] - Pseudomonas aeruginosa (strain PAO1) pimeloyl-CoA synthetase [Pseudomonas aeruginosa] Pos: 22/38 Gap: -1/-1 YsThs5PBjIkMH0RHIWDBtL341ow 15826983 7994677 11257037 4455696 13092530 527 E: .23E0 Ident: 20/60 Ident% 33 Q: 944-1003 (2346)   S: 16-72 (527) putative phosphoribosylaminoimidazolecarboxamide formyltransferase / IMP cyclohydrolase [Mycobacterium leprae] putative phosphoribosylaminoimidazolecarboxamide formyltransferase / IMP cyclohydrolase [Mycobacterium leprae] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] probable phosphoribosylaminoimidazolecarboxamide formyltransferase [imported] - Mycobacterium leprae putative phosphoribosylaminoimidazolecarboxamide formyltransferase [Mycobacterium leprae] putative phosphoribosylaminoimidazolecarboxamide formyltransferase / IMP cyclohydrolase [Mycobacterium leprae] putative phosphoribosylaminoimidazolecarboxamide formyltransferase / IMP cyclohydrolase [Mycobacterium leprae] Pos: 32/60 Gap: 3/60 HpVFveS8Z+ProtgStanKlCSali4 15924063 15926659 13700874 14246843 493 E: .042E0 Ident: 21/60 Ident% 35 Q: 944-1003 (2346)   S: 4-60 (493) bifunctional purine biosynthesis protein [Staphylococcus aureus subsp. aureus Mu50] bifunctional purine biosynthesis protein PurH [Staphylococcus aureus subsp. aureus N315] bifunctional purine biosynthesis protein PurH [Staphylococcus aureus subsp. aureus N315] bifunctional purine biosynthesis protein [Staphylococcus aureus subsp. aureus Mu50] Pos: 32/60 Gap: 3/60 0VJ1bOLYoYLpE4HU57tDgD+P0J4 16801015 16414450 1070 E: 0E0 Ident: 527/1061 Ident% 49 Q: 1-1058 (2346)   S: 1-1052 (1070) highly similar to carbamoyl-phosphate synthetase (catalytic subunit) [Listeria innocua] highly similar to carbamoyl-phosphate synthetase (catalytic subunit) [Listeria innocua] Pos: 725/1061 Gap: 12/1061 cAMQZUpBD5JaTYDHgVFouMKWQwk 2598551 1064 E: 0E0 Ident: 517/1067 Ident% 48 Q: 1-1058 (2346)   S: 1-1058 (1064) carbamoylphosphate synthetase [Lactococcus lactis] Pos: 705/1067 Gap: 18/1067 3abUmxAX+R/BWBr28jhC73rJP7k 9988775 1418 E: .11E0 Ident: 10/25 Ident% 40 Q: 558-582 (2346)   S: 1394-1418 (1418) carbamoyl phosphate synthetase II [Plasmodium chabaudi adami] carbamoyl phosphate synthetase II [Plasmodium chabaudi adami] carbamoyl phosphate synthetase II [Plasmodium chabaudi adami] Pos: 15/25 Gap: -1/-1 4/sAoLCEYm4Zm8+FRXfuCtgsMyk 17986422 17982016 398 E: .038E0 Ident: 28/222 Ident% 12 Q: 676-854 (2346)   S: 6-220 (398) SUCCINYL-COA SYNTHETASE BETA CHAIN [Brucella melitensis] SUCCINYL-COA SYNTHETASE BETA CHAIN [Brucella melitensis] SUCCINYL-COA SYNTHETASE BETA CHAIN [Brucella melitensis] SUCCINYL-COA SYNTHETASE BETA CHAIN [Brucella melitensis] Pos: 63/222 Gap: 50/222 3/MzfCkHUM6jKGGMKFY5UC1OlCo 5070361 134 E: .21E0 Ident: 22/117 Ident% 18 Q: 947-1056 (2346)   S: 8-124 (134) methylglyoxal synthase [Thermoanaerobacterium thermosaccharolyticum] Pos: 35/117 Gap: 7/117 WWIt01YGkKqoSiX9N81ZrsHgFx4 17228264 17130114 916 E: .001E0 Ident: 8/38 Ident% 21 Q: 132-169 (2346)   S: 515-552 (916) acetyl-CoA synthetase [Nostoc sp. PCC 7120] acetyl-CoA synthetase [Nostoc sp. PCC 7120] acetyl-CoA synthetase [Nostoc sp. PCC 7120] acetyl-CoA synthetase [Nostoc sp. PCC 7120] Pos: 19/38 Gap: -1/-1 aGa5NuLAZjUB/D6BzS+YuRsBK9Q 16127130 13424518 1099 E: 0E0 Ident: 671/1102 Ident% 60 Q: 1-1071 (2346)   S: 1-1099 (1099) carbamoyl-phosphate synthase, large subunit [Caulobacter crescentus] carbamoyl-phosphate synthase, large subunit [Caulobacter crescentus] Pos: 805/1102 Gap: 34/1102 1eqF+T+0pSt0QvXJrx+UnHnUE4E 15602087 13431794 12720447 533 E: .07E0 Ident: 19/47 Ident% 40 Q: 945-991 (2346)   S: 10-54 (533) Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Pos: 29/47 Gap: 2/47 luwOkfN+i0ovKCclnrlbqIw0NPI 18250631 723 E: .099E0 Ident: 9/42 Ident% 21 Q: 676-717 (2346)   S: 509-550 (723) feruloyl-CoA synthetase [Delftia acidovorans] feruloyl-CoA synthetase [Delftia acidovorans] Pos: 18/42 Gap: -1/-1 4ZkbbEYeHw6hDkEsypDaZL+msRY 16082611 365 E: .011E0 Ident: 14/96 Ident% 14 Q: 679-766 (2346)   S: 9-100 (365) Succinyl-CoA synthetase beta subunit [Thermoplasma acidophilum] Succinyl-CoA synthetase beta subunit [Thermoplasma acidophilum] Pos: 37/96 Gap: 12/96 FZX9IQAs9BSCQmZeqV3X6YRdd44 15281341 93 E: 2.1E0 Ident: 14/99 Ident% 14 Q: 9-107 (2346)   S: 2-86 (93) phosphoribosylamine-glycine ligase [Streptococcus suis] Pos: 28/99 Gap: 14/99 2s1fS/zsGYyoDPKqn6tVvGNAkoY 15608091 15840375 2829506 7437901 1524211 13880542 387 E: .002E0 Ident: 11/49 Ident% 22 Q: 676-724 (2346)   S: 6-54 (387) succinyl-CoA synthetase, beta subunit [Mycobacterium tuberculosis CDC1551] Succinyl-CoA synthetase beta chain (SCS-beta) probable succinyl-coa synthetase - Mycobacterium tuberculosis (strain H37RV) succinyl-CoA synthetase, beta subunit [Mycobacterium tuberculosis CDC1551] succinyl-CoA synthetase, beta subunit [Mycobacterium tuberculosis CDC1551] Succinyl-CoA synthetase beta chain (SCS-beta) probable succinyl-coa synthetase - Mycobacterium tuberculosis (strain H37RV) succinyl-CoA synthetase, beta subunit [Mycobacterium tuberculosis CDC1551] Pos: 19/49 Gap: -1/-1 f79+BAkSQleYAR76YqiCvJEytCU 1518088 1518 E: 0E0 Ident: 428/1085 Ident% 39 Q: 1-1071 (2346)   S: 414-1492 (1518) carbamoyl-phosphate synthetase III [Oncorhynchus mykiss] Pos: 650/1085 Gap: 20/1085 zSk7TTBsGMytiSBTNLNB294CZck 15826978 11272053 4455691 13092525 393 E: .002E0 Ident: 13/75 Ident% 17 Q: 676-746 (2346)   S: 6-77 (393) succinyl-CoA synthase [beta] chain [Mycobacterium leprae] probable succinyl-CoA synthetase beta subunit [imported] - Mycobacterium leprae probable succinyl-CoA synthetase beta subunit [Mycobacterium leprae] succinyl-CoA synthase [beta] chain [Mycobacterium leprae] succinyl-CoA synthase [beta] chain [Mycobacterium leprae] probable succinyl-CoA synthetase beta subunit [imported] - Mycobacterium leprae probable succinyl-CoA synthetase beta subunit [Mycobacterium leprae] succinyl-CoA synthase [beta] chain [Mycobacterium leprae] Pos: 27/75 Gap: 7/75 mnC208E/CD2oGT0DS8PCy6W691s 7490140 4008575 433 E: .77E0 Ident: 15/81 Ident% 18 Q: 676-744 (2346)   S: 28-108 (433) atp-specific succinyl-coa synthetase beta subunit - fission yeast (Schizosaccharomyces pombe) atp-specific succinyl-coa synthetase beta subunit - fission yeast (Schizosaccharomyces pombe) atp-specific succinyl-coa synthetase beta subuni t [Schizosaccharomyces pombe] atp-specific succinyl-coa synthetase beta subuni t [Schizosaccharomyces pombe] atp-specific succinyl-coa synthetase beta subunit - fission yeast (Schizosaccharomyces pombe) atp-specific succinyl-coa synthetase beta subunit - fission yeast (Schizosaccharomyces pombe) atp-specific succinyl-coa synthetase beta subuni t [Schizosaccharomyces pombe] atp-specific succinyl-coa synthetase beta subuni t [Schizosaccharomyces pombe] Pos: 30/81 Gap: 12/81 rAbfvwh1uHZ7/7qcfSXB0aQVn3Q 530209 1502 E: 0E0 Ident: 429/1084 Ident% 39 Q: 1-1070 (2346)   S: 417-1494 (1502) carbamyl phosphate synthetase III [Squalus acanthias] Pos: 656/1084 Gap: 20/1084 zzNAPp4F97DnU1mj+muEAJa8lEQ 4512117 388 E: .002E0 Ident: 15/67 Ident% 22 Q: 679-740 (2346)   S: 9-75 (388) succinyl-CoA synthetase beta subunit [Pseudomonas aeruginosa] succinyl-CoA synthetase beta subunit [Pseudomonas aeruginosa] Pos: 24/67 Gap: 5/67 8Q3gVKwA29BWABzDhGWe7aHye/A 15616764 11131697 10038827 1079 E: 0E0 Ident: 790/1073 Ident% 73 Q: 1-1073 (2346)   S: 1-1073 (1079) carbamoyl-phosphate synthase large chain [Buchnera sp. APS] Carbamoyl-phosphate synthase large chain (Carbamoyl-phosphate synthetase ammonia chain) Carbamoyl-phosphate synthase large chain (Carbamoyl-phosphate synthetase ammonia chain) carbamoyl-phosphate synthase large chain [Buchnera sp. APS] Pos: 940/1073 Gap: -1/-1 mp6XUF3UHvq77nblyuSb94qCrXc 15965329 15074509 1163 E: 0E0 Ident: 673/1161 Ident% 57 Q: 1-1068 (2346)   S: 1-1160 (1163) PROBABLE CARBAMOYL-PHOSPHATE SYNTHASE LARGE CHAIN (AMMONIA CHAIN ARGININE BIOSYNTHESIS) PROTEIN [Sinorhizobium meliloti] PROBABLE CARBAMOYL-PHOSPHATE SYNTHASE LARGE CHAIN (AMMONIA CHAIN ARGININE BIOSYNTHESIS) PROTEIN [Sinorhizobium meliloti] PROBABLE CARBAMOYL-PHOSPHATE SYNTHASE LARGE CHAIN (AMMONIA CHAIN ARGININE BIOSYNTHESIS) PROTEIN [Sinorhizobium meliloti] PROBABLE CARBAMOYL-PHOSPHATE SYNTHASE LARGE CHAIN (AMMONIA CHAIN ARGININE BIOSYNTHESIS) PROTEIN [Sinorhizobium meliloti] Pos: 806/1161 Gap: 94/1161 x2fJLQmAnw+KZ1rKCVqqBsfhmbA 17545273 17427564 388 E: .18E0 Ident: 8/40 Ident% 20 Q: 679-717 (2346)   S: 9-48 (388) PROBABLE SUCCINYL-COA SYNTHETASE BETA CHAIN PROTEIN [Ralstonia solanacearum] PROBABLE SUCCINYL-COA SYNTHETASE BETA CHAIN PROTEIN [Ralstonia solanacearum] PROBABLE SUCCINYL-COA SYNTHETASE BETA CHAIN PROTEIN [Ralstonia solanacearum] PROBABLE SUCCINYL-COA SYNTHETASE BETA CHAIN PROTEIN [Ralstonia solanacearum] Pos: 20/40 Gap: 1/40 qKr3MqsgAeRFZkokIseSNSUmfPQ 16765971 16421201 886 E: 3.3E0 Ident: 16/113 Ident% 14 Q: 681-779 (2346)   S: 489-600 (886) putative acetyl-CoA synthetase [Salmonella typhimurium LT2] putative acetyl-CoA synthetase [Salmonella typhimurium LT2] putative acetyl-CoA synthetase [Salmonella typhimurium LT2] putative acetyl-CoA synthetase [Salmonella typhimurium LT2] Pos: 39/113 Gap: 15/113 FTQhrwwVUzr8MqIoqXPglqS1UcU 15792282 11257046 6968390 510 E: .005E0 Ident: 22/48 Ident% 45 Q: 944-991 (2346)   S: 2-47 (510) phosphoribosylaminoimidazolecarboxamide formyltransferase / IMP cyclohydrolase [Campylobacter jejuni] phosphoribosylaminoimidazolecarboxamide formyltransferase / IMP cyclohydrolase [Campylobacter jejuni] phosphoribosylaminoimidazolecarboxamide formyltransferase / IMP cyclohydrolase [Campylobacter jejuni] phosphoribosylaminoimidazolecarboxamide formyltransferase / IMP cyclohydrolase [Campylobacter jejuni] Pos: 28/48 Gap: 2/48 potEbycYVN6+6+FUdxgmXLLd4J8 3891747 3891749 3891751 3891753 1058 E: 0E0 Ident: 1056/1073 Ident% 98 Q: 1-1073 (2346)   S: 1-1058 (1058) Chain A, Carbamoyl Phosphate Synthetase: Caught In The Act Of Glutamine Hydrolysis Chain C, Carbamoyl Phosphate Synthetase: Caught In The Act Of Glutamine Hydrolysis Chain E, Carbamoyl Phosphate Synthetase: Caught In The Act Of Glutamine Hydrolysis Chain G, Carbamoyl Phosphate Synthetase: Caught In The Act Of Glutamine Hydrolysis Pos: 1056/1073 Gap: 15/1073 xgo6xHUzXwenkD1yVYY6lTwA694 11498873 7438084 2649305 1076 E: 0E0 Ident: 627/1078 Ident% 58 Q: 1-1071 (2346)   S: 1-1075 (1076) carbamoyl-phosphate synthase, large (or ammonia) subunit (carB) [Archaeoglobus fulgidus] carbamoyl-phosphate synthase (glutamine-hydrolyzing) (EC 6.3.5.5) large chain - Archaeoglobus fulgidus carbamoyl-phosphate synthase, large (or ammonia) subunit (carB) [Archaeoglobus fulgidus] Pos: 812/1078 Gap: 10/1078 /W4qII2Ckp0v2+x2bxWFzcqR3wM 7490180 3873545 1160 E: 0E0 Ident: 422/1080 Ident% 39 Q: 6-1073 (2346)   S: 85-1149 (1160) carbamoyl-phosphate synthase (glutamine-hydrolyzing) (EC 6.3.5.5) large chain [similarity] - fission yeast (Schizosaccharomyces pombe) carbamoyl-phosphate synthase [Schizosaccharomyces pombe] Pos: 637/1080 Gap: 27/1080 Q4MQE1I5c7hhzZ15sabLqYY2+7c 16123865 15981644 529 E: .077E0 Ident: 21/48 Ident% 43 Q: 944-991 (2346)   S: 9-54 (529) bifunctional purine biosynthesis protein PurH [includes: phosphoribosylaminoimidazolecarboxamide formyltransferase and IMP cyclohydrolase [Yersinia pestis] bifunctional purine biosynthesis protein PurH [includes: phosphoribosylaminoimidazolecarboxamide formyltransferase and IMP cyclohydrolase [Yersinia pestis] bifunctional purine biosynthesis protein PurH [includes: phosphoribosylaminoimidazolecarboxamide formyltransferase and IMP cyclohydrolase [Yersinia pestis] bifunctional purine biosynthesis protein PurH [includes: phosphoribosylaminoimidazolecarboxamide formyltransferase and IMP cyclohydrolase [Yersinia pestis] bifunctional purine biosynthesis protein PurH [includes: phosphoribosylaminoimidazolecarboxamide formyltransferase and IMP cyclohydrolase [Yersinia pestis] bifunctional purine biosynthesis protein PurH [includes: phosphoribosylaminoimidazolecarboxamide formyltransferase and IMP cyclohydrolase [Yersinia pestis] Pos: 30/48 Gap: 2/48 NchqOnZHH/2zuka/HQPU1BnM8tQ 15613196 10173247 511 E: .03E0 Ident: 24/63 Ident% 38 Q: 941-1003 (2346)   S: 1-60 (511) phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Bacillus halodurans] phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Bacillus halodurans] phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Bacillus halodurans] phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Bacillus halodurans] Pos: 32/63 Gap: 3/63 6TGDMf1YFAMjFMOQUTmj1NSRB74 13541105 365 E: .012E0 Ident: 16/96 Ident% 16 Q: 679-766 (2346)   S: 9-100 (365) Succinyl-CoA synthetase beta subunit [Thermoplasma volcanium] Succinyl-CoA synthetase beta subunit [Thermoplasma volcanium] Pos: 34/96 Gap: 12/96 yl8mJDKR3d0ebldqY2kEOfkUYug 15924193 15926786 13701002 14246973 1057 E: 0E0 Ident: 522/1060 Ident% 49 Q: 1-1057 (2346)   S: 1-1050 (1057) carbamoyl-phosphate synthase large chain [Staphylococcus aureus subsp. aureus Mu50] carbamoyl-phosphate synthase large chain [Staphylococcus aureus subsp. aureus N315] carbamoyl-phosphate synthase large chain [Staphylococcus aureus subsp. aureus N315] carbamoyl-phosphate synthase large chain [Staphylococcus aureus subsp. aureus Mu50] Pos: 721/1060 Gap: 13/1060 o12FuNHc5LITzUUTtIffgNup8Ag 15606514 7521711 2983723 436 E: .32E0 Ident: 11/85 Ident% 12 Q: 680-754 (2346)   S: 11-94 (436) succinyl-CoA ligase beta subunit [Aquifex aeolicus] succinyl-CoA ligase beta subunit - Aquifex aeolicus succinyl-CoA ligase beta subunit [Aquifex aeolicus] succinyl-CoA ligase beta subunit [Aquifex aeolicus] succinyl-CoA ligase beta subunit - Aquifex aeolicus succinyl-CoA ligase beta subunit [Aquifex aeolicus] Pos: 32/85 Gap: 11/85 kh11r+AzwSd7xTJ6fD+nkyYl39s 18309668 18144345 501 E: .1E0 Ident: 16/56 Ident% 28 Q: 941-996 (2346)   S: 1-54 (501) bifunctional purine biosynthesis protein [Clostridium perfringens] bifunctional purine biosynthesis protein [Clostridium perfringens] Pos: 30/56 Gap: 2/56 m80VEgAGq4ABASQnTqdcCGRK9hs 15676852 11272060 7226199 388 E: .035E0 Ident: 10/66 Ident% 15 Q: 676-736 (2346)   S: 6-71 (388) succinyl-CoA synthetase, beta subunit [Neisseria meningitidis MC58] succinyl-CoA synthetase, beta chain NMB0959 [imported] - Neisseria meningitidis (group B strain MD58) succinyl-CoA synthetase, beta subunit [Neisseria meningitidis MC58] succinyl-CoA synthetase, beta subunit [Neisseria meningitidis MC58] succinyl-CoA synthetase, beta chain NMB0959 [imported] - Neisseria meningitidis (group B strain MD58) succinyl-CoA synthetase, beta subunit [Neisseria meningitidis MC58] Pos: 21/66 Gap: 5/66 tH+2QCn8Sd174cFPrnZpH8ASPuo 15640305 11257034 9654686 530 E: .007E0 Ident: 28/86 Ident% 32 Q: 944-1016 (2346)   S: 9-92 (530) phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Vibrio cholerae] phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Vibrio cholerae] phosphoribosylaminoimidazolecarboxamide formyltransferase/ IMP cyclohydrolase VC0276 [imported] - Vibrio cholerae (group O1 strain N16961) phosphoribosylaminoimidazolecarboxamide formyltransferase/ IMP cyclohydrolase VC0276 [imported] - Vibrio cholerae (group O1 strain N16961) phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Vibrio cholerae] phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Vibrio cholerae] Pos: 42/86 Gap: 15/86 7J2ZqUi2SpE4w600wUVs9V+dfH4 16800943 16414378 509 E: .025E0 Ident: 20/53 Ident% 37 Q: 944-996 (2346)   S: 3-53 (509) Bifunctional phosphoribosylaminoimidazole carboxy formyl formyltransferase and inosine-monophosphate cyclohydrolase [Listeria innocua] Bifunctional phosphoribosylaminoimidazole carboxy formyl formyltransferase and inosine-monophosphate cyclohydrolase [Listeria innocua] Bifunctional phosphoribosylaminoimidazole carboxy formyl formyltransferase and inosine-monophosphate cyclohydrolase [Listeria innocua] Bifunctional phosphoribosylaminoimidazole carboxy formyl formyltransferase and inosine-monophosphate cyclohydrolase [Listeria innocua] Pos: 29/53 Gap: 2/53 EDeiwbu1ixG158PN3TFg8jTI/UU 15967075 15076348 536 E: .007E0 Ident: 24/60 Ident% 40 Q: 944-1003 (2346)   S: 18-74 (536) PROBABLE BIFUNCTIONAL INCLUDES: PHOSPHORIBOSYLAMINOIMIDAZOLECARBOXAMIDE FORMYLTRANSFERASE AND IMP CYCLOHYDROLASE PROTEIN [Sinorhizobium meliloti] PROBABLE BIFUNCTIONAL INCLUDES: PHOSPHORIBOSYLAMINOIMIDAZOLECARBOXAMIDE FORMYLTRANSFERASE AND IMP CYCLOHYDROLASE PROTEIN [Sinorhizobium meliloti] PROBABLE BIFUNCTIONAL INCLUDES: PHOSPHORIBOSYLAMINOIMIDAZOLECARBOXAMIDE FORMYLTRANSFERASE AND IMP CYCLOHYDROLASE PROTEIN [Sinorhizobium meliloti] PROBABLE BIFUNCTIONAL INCLUDES: PHOSPHORIBOSYLAMINOIMIDAZOLECARBOXAMIDE FORMYLTRANSFERASE AND IMP CYCLOHYDROLASE PROTEIN [Sinorhizobium meliloti] Pos: 33/60 Gap: 3/60 td3jUYJ9bJd9r53QchPnsCN13y8 12845904 355 E: .091E0 Ident: 20/56 Ident% 35 Q: 939-994 (2346)   S: 1-54 (355) 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase~data source:MGD, source key:MGI:1351352, evidence:ISS~putative [Mus musculus] 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase~data source:MGD, source key:MGI:1351352, evidence:ISS~putative [Mus musculus] Pos: 29/56 Gap: 2/56 rB4vq0Xv/F3aUB/xGxuxbCdi3hI 7415859 110 E: .02E0 Ident: 22/48 Ident% 45 Q: 944-991 (2346)   S: 9-54 (110) phosphoribosyl aminoimiddazol carboxamide formyltransferase [Escherichia coli O157:H7] Pos: 28/48 Gap: 2/48 Yp8oJ4XiK2zymSyAUiFQudKG1Fk 15673500 13878680 12724516 518 E: .088E0 Ident: 22/63 Ident% 34 Q: 941-1003 (2346)   S: 1-60 (518) bifunctional purine biosynthesis protein PurH [Lactococcus lactis subsp. lactis] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] bifunctional purine biosynthesis protein PurH [Lactococcus lactis subsp. lactis] Pos: 36/63 Gap: 3/63 R95MtfKFVl39LHZkYpxnKXEiRVs 13474206 14024958 694 E: 8.9E0 Ident: 27/155 Ident% 17 Q: 89-229 (2346)   S: 437-589 (694) hypothetical protein, similar to acetyl-CoA synthetase [Mesorhizobium loti] hypothetical protein, similar to acetyl-CoA synthetase [Mesorhizobium loti] Pos: 48/155 Gap: 16/155 8fP5EH4N65FiWECyQCfMA0tAuHY 16332321 7994675 7433572 1653951 553 E: .3E0 Ident: 21/48 Ident% 43 Q: 945-991 (2346)   S: 47-92 (553) phosphoribosyl aminoimidazole carboxy formyl formyltransferase/inosinemonophosphate cyclohydrolase; PUR-H(J) [Synechocystis sp. PCC 6803] phosphoribosyl aminoimidazole carboxy formyl formyltransferase/inosinemonophosphate cyclohydrolase; PUR-H(J) [Synechocystis sp. PCC 6803] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] phosphoribosyl aminoimidazole carboxy formyl formyltransferase/inosinemonophosphate cyclohydrolase; PUR-H(J) [Synechocystis sp. PCC 6803] phosphoribosyl aminoimidazole carboxy formyl formyltransferase/inosinemonophosphate cyclohydrolase; PUR-H(J) [Synechocystis sp. PCC 6803] Pos: 30/48 Gap: 3/48 U1uTe30EmLwvwBaLW9IokRftTRE 18397283 1477480 9972356 14194125 1187 E: 0E0 Ident: 612/1078 Ident% 56 Q: 3-1063 (2346)   S: 94-1169 (1187) carbamoylphosphate synthetase, putative [Arabidopsis thaliana] carbamoyl phosphate synthetase large chain [Arabidopsis thaliana] carbamoyl phosphate synthetase large chain (carB) [Arabidopsis thaliana] Pos: 776/1078 Gap: 19/1078 BILY+deBp9b22uCOO83K1DvTS+E 16763457 16418563 1075 E: 0E0 Ident: 1054/1073 Ident% 98 Q: 1-1073 (2346)   S: 1-1073 (1075) carbamoyl-phosphate synthase, large subunit [Salmonella typhimurium LT2] carbamoyl-phosphate synthase, large subunit [Salmonella typhimurium LT2] Pos: 1064/1073 Gap: -1/-1 Rq536a9yzJhLIqpeM6ugtQO05vE 4503019 87018 219553 1500 E: 0E0 Ident: 420/1082 Ident% 38 Q: 4-1071 (2346)   S: 419-1494 (1500) carbamoyl-phosphate synthetase 1, mitochondrial [Homo sapiens] carbamoyl-phosphate synthase (ammonia) (EC 6.3.4.16) precursor - human carbamyl phosphate synthetase I (EC 6.3.4.16) [Homo sapiens] Pos: 659/1082 Gap: 20/1082 VDR72ZhV9EM8EcnJPFOO5nxgJJI 16124592 13421486 399 E: .003E0 Ident: 12/81 Ident% 14 Q: 678-743 (2346)   S: 8-88 (399) succinyl-CoA synthetase, beta subunit [Caulobacter crescentus] succinyl-CoA synthetase, beta subunit [Caulobacter crescentus] succinyl-CoA synthetase, beta subunit [Caulobacter crescentus] succinyl-CoA synthetase, beta subunit [Caulobacter crescentus] Pos: 26/81 Gap: 15/81 ovQXNkE06F+H8a55jUPLitHLuEc 15966005 15075275 687 E: .44E0 Ident: 27/158 Ident% 17 Q: 85-233 (2346)   S: 436-591 (687) PUTATIVE ACYL-COA SYNTHETASE PROTEIN [Sinorhizobium meliloti] PUTATIVE ACYL-COA SYNTHETASE PROTEIN [Sinorhizobium meliloti] Pos: 53/158 Gap: 11/158 /azWIphnUmTxQu7o0qLbbwTy3hc 3766199 404 E: 4.7E0 Ident: 8/50 Ident% 16 Q: 676-724 (2346)   S: 15-64 (404) GTP-specific succinyl-CoA synthetase beta subunit [Homo sapiens] GTP-specific succinyl-CoA synthetase beta subunit [Homo sapiens] GTP-specific succinyl-CoA synthetase beta subunit [Homo sapiens] GTP-specific succinyl-CoA synthetase beta subunit [Homo sapiens] Pos: 19/50 Gap: 1/50 SabN+dwV8gGCpeN4L9VG5kp3f8k 3808237 425 E: .011E0 Ident: 11/73 Ident% 15 Q: 676-736 (2346)   S: 20-92 (425) ATP-specific succinyl-CoA synthetase beta subunit [Sus scrofa] ATP-specific succinyl-CoA synthetase beta subunit [Sus scrofa] ATP-specific succinyl-CoA synthetase beta subunit [Sus scrofa] ATP-specific succinyl-CoA synthetase beta subunit [Sus scrofa] Pos: 27/73 Gap: 12/73 KaeIgn+8/gDlFkffc5lNG9bCocY 13541634 14325033 1044 E: 0E0 Ident: 429/1074 Ident% 39 Q: 1-1069 (2346)   S: 1-1044 (1044) Carbamoylphosphate synthase large subunit [Thermoplasma volcanium] carbamoyl-phosphate synthase beta subunit [Thermoplasma volcanium] Pos: 634/1074 Gap: 35/1074 f3xhv5Vka3onesKFNCMirq4QVwQ 15794640 11272177 7380389 318 E: .017E0 Ident: 42/311 Ident% 13 Q: 22-328 (2346)   S: 23-313 (318) glutathione synthetase [Neisseria meningitidis Z2491] glutathione synthase (EC 6.3.2.3) NMA1747 [imported] - Neisseria meningitidis (group A strain Z2491) glutathione synthetase [Neisseria meningitidis Z2491] glutathione synthetase [Neisseria meningitidis Z2491] glutathione synthase (EC 6.3.2.3) NMA1747 [imported] - Neisseria meningitidis (group A strain Z2491) glutathione synthetase [Neisseria meningitidis Z2491] Pos: 92/311 Gap: 24/311 0Gk5YljcbCe5t++YBzNG/pIL6GE 15214204 3688571 14268499 585 E: .29E0 Ident: 17/52 Ident% 32 Q: 945-996 (2346)   S: 3-52 (585) BIFUNCTIONAL PURINE BIOSYNTHESIS PROTEIN ADE10 [INCLUDES: PHOSPHORIBOSYLAMINOIMIDAZOLECARBOXAMIDE FORMYLTRANSFERASE (AICAR TRANSFORMYLASE); IMP CYCLOHYDROLASE (INOSINICASE) (IMP SYNTHETASE) (ATIC)] BIFUNCTIONAL PURINE BIOSYNTHESIS PROTEIN ADE10 [INCLUDES: PHOSPHORIBOSYLAMINOIMIDAZOLECARBOXAMIDE FORMYLTRANSFERASE (AICAR TRANSFORMYLASE); IMP CYCLOHYDROLASE (INOSINICASE) (IMP SYNTHETASE) (ATIC)] BIFUNCTIONAL PURINE BIOSYNTHESIS PROTEIN ADE10 [INCLUDES: PHOSPHORIBOSYLAMINOIMIDAZOLECARBOXAMIDE FORMYLTRANSFERASE (AICAR TRANSFORMYLASE); IMP CYCLOHYDROLASE (INOSINICASE) (IMP SYNTHETASE) (ATIC)] BIFUNCTIONAL PURINE BIOSYNTHESIS PROTEIN ADE10 [INCLUDES: PHOSPHORIBOSYLAMINOIMIDAZOLECARBOXAMIDE FORMYLTRANSFERASE (AICAR TRANSFORMYLASE); IMP CYCLOHYDROLASE (INOSINICASE) (IMP SYNTHETASE) (ATIC)] IMP cyclohydrolase; phosphoribosylaminoimidazolecarboxamide formyltransferase [Schizosaccharomyces pombe] IMP cyclohydrolase; phosphoribosylaminoimidazolecarboxamide formyltransferase [Schizosaccharomyces pombe] putative 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR) transformylase/IMP cyclohydrolase [Schizosaccharomyces pombe] Pos: 30/52 Gap: 2/52 zcbRMLBv7QVi+YQiHkpxCAui9cg 15604298 3915040 7437893 2073500 3860990 386 E: .057E0 Ident: 21/177 Ident% 11 Q: 676-836 (2346)   S: 6-173 (386) SUCCINYL-COA SYNTHETASE BETA CHAIN (sucC) [Rickettsia prowazekii] Succinyl-CoA synthetase beta chain (SCS-beta) succinyl-COA synthetase beta chain (sucC) RP433 - Rickettsia prowazekii succinyl-CoA synthetase beta-subunit [Rickettsia prowazekii] SUCCINYL-COA SYNTHETASE BETA CHAIN (sucC) [Rickettsia prowazekii] SUCCINYL-COA SYNTHETASE BETA CHAIN (sucC) [Rickettsia prowazekii] Succinyl-CoA synthetase beta chain (SCS-beta) succinyl-COA synthetase beta chain (sucC) RP433 - Rickettsia prowazekii succinyl-CoA synthetase beta-subunit [Rickettsia prowazekii] SUCCINYL-COA SYNTHETASE BETA CHAIN (sucC) [Rickettsia prowazekii] Pos: 53/177 Gap: 25/177 d5WIMCIGQQsC4MxsY1V8lahQo60 16766396 16421648 315 E: 7.1E0 Ident: 19/134 Ident% 14 Q: 78-211 (2346)   S: 75-202 (315) glutathione synthetase [Salmonella typhimurium LT2] glutathione synthetase [Salmonella typhimurium LT2] Pos: 37/134 Gap: 6/134 tgbwH+D6CEYmas7nS02eSh+KRSI 18310236 18144915 468 E: .55E0 Ident: 17/114 Ident% 14 Q: 7-105 (2346)   S: 140-251 (468) glutamate synthase beta subunit [Clostridium perfringens] glutamate synthase beta subunit [Clostridium perfringens] Pos: 38/114 Gap: 17/114 XNljgEluSIqT/vw1T8qKpjyub70 16762281 16504585 529 E: .053E0 Ident: 21/48 Ident% 43 Q: 944-991 (2346)   S: 9-54 (529) phosphoribosylaminoimidazolecarboxamide formyltransferase and IMP cyclohydrolase (bifunctional enzyme) [Salmonella enterica subsp. enterica serovar Typhi] phosphoribosylaminoimidazolecarboxamide formyltransferase and IMP cyclohydrolase (bifunctional enzyme) [Salmonella enterica subsp. enterica serovar Typhi] phosphoribosylaminoimidazolecarboxamide formyltransferase and IMP cyclohydrolase (bifunctional enzyme) [Salmonella enterica subsp. enterica serovar Typhi] phosphoribosylaminoimidazolecarboxamide formyltransferase and IMP cyclohydrolase (bifunctional enzyme) [Salmonella enterica subsp. enterica serovar Typhi] Pos: 28/48 Gap: 2/48 tyLBwpI4wz6KJbGYNCQ+tZc776I 15800432 15830007 16128703 135026 68576 18655524 18655526 1065086 1065088 5822496 5822498 146203 1651323 1786948 12513646 13360212 388 E: .003E0 Ident: 18/69 Ident% 26 Q: 676-739 (2346)   S: 6-74 (388) succinyl-CoA synthetase, beta subunit [Escherichia coli O157:H7 EDL933] succinyl-CoA synthetase beta subunit [Escherichia coli O157:H7] succinyl-CoA synthetase, beta subunit [Escherichia coli K12] Succinyl-CoA synthetase beta chain (SCS-beta) succinate--CoA ligase (ADP-forming) (EC 6.2.1.5) beta chain - Escherichia coli Chain B, Succinyl-Coa Synthetase (Succinate-Coa Ligase) (Adp-Forming) (E.C.6.2.1.5) Chain B, Succinyl-Coa Synthetase (Succinate-Coa Ligase) (Adp-Forming) (E.C.6.2.1.5) Chain E, Succinyl-Coa Synthetase (Succinate-Coa Ligase) (Adp-Forming) (E.C.6.2.1.5) Chain E, Succinyl-Coa Synthetase (Succinate-Coa Ligase) (Adp-Forming) (E.C.6.2.1.5) Chain B, A Detailed Description Of The Structure Of Succinyl-Coa Synthetase From Escherichia Coli Chain E, A Detailed Description Of The Structure Of Succinyl-Coa Synthetase From Escherichia Coli succinyl-CoA synthetase beta-subunit [Escherichia coli] Succinate-CoA ligase (ADP-forming) (EC 6.2.1.5) beta chain. [Escherichia coli] succinyl-CoA synthetase, beta subunit [Escherichia coli K12] succinyl-CoA synthetase, beta subunit [Escherichia coli O157:H7 EDL933] succinyl-CoA synthetase beta subunit [Escherichia coli O157:H7] succinyl-CoA synthetase, beta subunit [Escherichia coli O157:H7 EDL933] succinyl-CoA synthetase beta subunit [Escherichia coli O157:H7] succinyl-CoA synthetase, beta subunit [Escherichia coli K12] Succinyl-CoA synthetase beta chain (SCS-beta) succinate--CoA ligase (ADP-forming) (EC 6.2.1.5) beta chain - Escherichia coli Chain B, Succinyl-Coa Synthetase (Succinate-Coa Ligase) (Adp-Forming) (E.C.6.2.1.5) Chain B, Succinyl-Coa Synthetase (Succinate-Coa Ligase) (Adp-Forming) (E.C.6.2.1.5) Chain E, Succinyl-Coa Synthetase (Succinate-Coa Ligase) (Adp-Forming) (E.C.6.2.1.5) Chain E, Succinyl-Coa Synthetase (Succinate-Coa Ligase) (Adp-Forming) (E.C.6.2.1.5) Chain B, A Detailed Description Of The Structure Of Succinyl-Coa Synthetase From Escherichia Coli Chain E, A Detailed Description Of The Structure Of Succinyl-Coa Synthetase From Escherichia Coli succinyl-CoA synthetase beta-subunit [Escherichia coli] Succinate-CoA ligase (ADP-forming) (EC 6.2.1.5) beta chain. [Escherichia coli] succinyl-CoA synthetase, beta subunit [Escherichia coli K12] succinyl-CoA synthetase, beta subunit [Escherichia coli O157:H7 EDL933] succinyl-CoA synthetase beta subunit [Escherichia coli O157:H7] Pos: 29/69 Gap: 5/69 iJsXfOV8IRo7Wr4jlrE8Nyuxfnc 3821927 413 E: .067E0 Ident: 36/210 Ident% 17 Q: 681-859 (2346)   S: 13-217 (413) ATP-specific succinyl-CoA synthetase beta subunit [Columba livia] ATP-specific succinyl-CoA synthetase beta subunit [Columba livia] ATP-specific succinyl-CoA synthetase beta subunit [Columba livia] ATP-specific succinyl-CoA synthetase beta subunit [Columba livia] Pos: 71/210 Gap: 36/210 ctUD8uOEz+70jTAwW0e/bWp5OA4 12006346 17390429 414 E: .14E0 Ident: 31/236 Ident% 13 Q: 645-847 (2346)   S: 76-301 (414) inositol 3,4,5,6 tetrakisphosphate 1-kinase/inositol 1,3,4-trisphosphate 5/6-kinase [Homo sapiens] inositol 1,3,4-triphosphate 5/6 kinase [Homo sapiens] inositol 3,4,5,6 tetrakisphosphate 1-kinase/inositol 1,3,4-trisphosphate 5/6-kinase [Homo sapiens] inositol 1,3,4-triphosphate 5/6 kinase [Homo sapiens] Pos: 81/236 Gap: 43/236 lHzZlM+llPn0ofkbra7UCsyytz8 3929335 2697121 140 E: .3E0 Ident: 10/94 Ident% 10 Q: 859-952 (2346)   S: 1-90 (140) BIOTIN CARBOXYLASE (A SUBUNIT OF ACETYL-COA CARBOXYLASE (ACC) biotin carboxylase homolog [Allochromatium vinosum] BIOTIN CARBOXYLASE (A SUBUNIT OF ACETYL-COA CARBOXYLASE (ACC) biotin carboxylase homolog [Allochromatium vinosum] Pos: 26/94 Gap: 4/94 yRkyxp2oLAyIZBOQSaY91kC1r5E 13542064 14325495 693 E: .002E0 Ident: 25/185 Ident% 13 Q: 120-289 (2346)   S: 475-654 (693) Acyl-CoA synthetase (NDP forming) [Thermoplasma volcanium] succinyl CoA synthetase alpha subunit [Thermoplasma volcanium] Acyl-CoA synthetase (NDP forming) [Thermoplasma volcanium] succinyl CoA synthetase alpha subunit [Thermoplasma volcanium] Pos: 68/185 Gap: 20/185 VHoyax5dnQV9U9NWFQt6PXgZ46o 15903196 15458783 1058 E: 0E0 Ident: 518/1061 Ident% 48 Q: 1-1058 (2346)   S: 1-1052 (1058) Carbamoylphosphate synthase (ammonia), heavy subunit [Streptococcus pneumoniae R6] Carbamoylphosphate synthase (ammonia), heavy subunit [Streptococcus pneumoniae R6] Pos: 721/1061 Gap: 12/1061 erAwu1AEMsSiknBRCZkkxiluws0 9955022 396 E: 4.9E0 Ident: 9/50 Ident% 18 Q: 676-724 (2346)   S: 7-56 (396) Chain B, Crystal Structure Of Phosphorylated Pig Heart, Gtp-Specific Succinyl-Coa Synthetase Chain B, Crystal Structure Of Phosphorylated Pig Heart, Gtp-Specific Succinyl-Coa Synthetase Chain B, Crystal Structure Of Phosphorylated Pig Heart, Gtp-Specific Succinyl-Coa Synthetase Chain B, Crystal Structure Of Phosphorylated Pig Heart, Gtp-Specific Succinyl-Coa Synthetase Pos: 19/50 Gap: 1/50 zdItogMTGRbf0zR0Z70iRQiXISA 16803229 16410605 183 E: 5.3E0 Ident: 13/76 Ident% 17 Q: 436-507 (2346)   S: 86-156 (183) similar to transcriptional regulator [Listeria monocytogenes EGD-e] similar to transcriptional regulator [Listeria monocytogenes EGD-e] similar to transcriptional regulator [Listeria monocytogenes] similar to transcriptional regulator [Listeria monocytogenes] Pos: 30/76 Gap: 9/76 EdgkQVMBQJgqb04YBLLWrUrrANg 15225353 11272036 3660469 6598664 421 E: 6.7E0 Ident: 9/49 Ident% 18 Q: 680-724 (2346)   S: 36-83 (421) succinyl-CoA ligase beta subunit [Arabidopsis thaliana] succinate--CoA ligase (ADP-forming) (EC 6.2.1.5) beta chain [imported] - Arabidopsis thaliana succinyl-CoA-ligase beta subunit [Arabidopsis thaliana] succinyl-CoA ligase beta subunit [Arabidopsis thaliana] succinyl-CoA ligase beta subunit [Arabidopsis thaliana] succinate--CoA ligase (ADP-forming) (EC 6.2.1.5) beta chain [imported] - Arabidopsis thaliana succinyl-CoA-ligase beta subunit [Arabidopsis thaliana] succinyl-CoA ligase beta subunit [Arabidopsis thaliana] Pos: 22/49 Gap: 5/49 VONv/QLb9djqVPifrIkjhQFk6pQ 1168772 2118367 312443 1065 E: 0E0 Ident: 551/1060 Ident% 51 Q: 1-1057 (2346)   S: 1-1051 (1065) CARBAMOYL-PHOSPHATE SYNTHASE, PYRIMIDINE-SPECIFIC, LARGE CHAIN (CARBAMOYL-PHOSPHATE SYNTHETASE AMMONIA CHAIN) CARBAMOYL-PHOSPHATE SYNTHASE, PYRIMIDINE-SPECIFIC, LARGE CHAIN (CARBAMOYL-PHOSPHATE SYNTHETASE AMMONIA CHAIN) carbamoyl-phosphate synthase (glutamine-hydrolyzing) (EC 6.3.5.5) - Bacillus caldolyticus carbamoyl-phosphate synthase (glutamine-hydrolysing) [Bacillus caldolyticus] Pos: 743/1060 Gap: 12/1060 sz/FxRmUziVvrlOODhsQM+oYHks 17230585 17132187 506 E: 6.3E0 Ident: 19/49 Ident% 38 Q: 945-992 (2346)   S: 5-51 (506) bifunctional purine biosynthesis protein [Nostoc sp. PCC 7120] bifunctional purine biosynthesis protein [Nostoc sp. PCC 7120] Pos: 30/49 Gap: 3/49 LCHeDEnia1Kg9aBJKZQyPGfaCJo 3024509 2118285 951096 2242 E: 0E0 Ident: 421/1072 Ident% 39 Q: 2-1055 (2346)   S: 391-1448 (2242) CAD protein [Includes: Glutamine-dependent carbamoyl-phosphate synthase ; Aspartate carbamoyltransferase ; Dihydroorotase ] CAD protein [Includes: Glutamine-dependent carbamoyl-phosphate synthase ; Aspartate carbamoyltransferase ; Dihydroorotase ] Pos: 629/1072 Gap: 32/1072 n3t87q/Y6ks/HVkPcr0pLRbpzWA 15889893 17936513 15157842 17741140 397 E: .54E0 Ident: 11/50 Ident% 22 Q: 676-724 (2346)   S: 6-55 (397) succinyl-CoA synthetase beta chain [Agrobacterium tumefaciens str. C58 (U. Washington)] succinyl-CoA synthetase beta chain [Agrobacterium tumefaciens str. C58 (U. Washington)] succinyl-CoA synthetase beta chain [Agrobacterium tumefaciens str. C58 (U. Washington)] succinyl-CoA synthetase beta chain [Agrobacterium tumefaciens str. C58 (U. Washington)] Pos: 20/50 Gap: 1/50 AEJZc40OqWfUZiITdbcQtLRC/xc 16803805 16411219 509 E: .013E0 Ident: 20/53 Ident% 37 Q: 944-996 (2346)   S: 3-53 (509) Bifunctional phosphoribosylaminoimidazole carboxy formyl formyltransferase and inosine-monophosphate cyclohydrolase [Listeria monocytogenes EGD-e] Bifunctional phosphoribosylaminoimidazole carboxy formyl formyltransferase and inosine-monophosphate cyclohydrolase [Listeria monocytogenes EGD-e] Bifunctional phosphoribosylaminoimidazole carboxy formyl formyltransferase and inosine-monophosphate cyclohydrolase [Listeria monocytogenes] Bifunctional phosphoribosylaminoimidazole carboxy formyl formyltransferase and inosine-monophosphate cyclohydrolase [Listeria monocytogenes] Pos: 30/53 Gap: 2/53 VBLiP3ge1/AIG3sA7DlouATpFBo 2133791 1502 E: 0E0 Ident: 428/1084 Ident% 39 Q: 1-1070 (2346)   S: 417-1494 (1502) carbamoyl-phosphate synthase (glutamine-hydrolyzing) (EC 6.3.5.5) III precursor, hepatic - spiny dogfish Pos: 655/1084 Gap: 20/1084 N321JVaV/IEZlBsUvirv43WAQlk 15677410 11272179 7226806 319 E: 5.3E0 Ident: 31/256 Ident% 12 Q: 22-276 (2346)   S: 24-267 (319) glutathione synthetase [Neisseria meningitidis MC58] glutathione synthetase NMB1559 [imported] - Neisseria meningitidis (group B strain MD58) glutathione synthetase [Neisseria meningitidis MC58] glutathione synthetase [Neisseria meningitidis MC58] glutathione synthetase NMB1559 [imported] - Neisseria meningitidis (group B strain MD58) glutathione synthetase [Neisseria meningitidis MC58] Pos: 75/256 Gap: 13/256 zrF0jnpOmHv9RQYKCdcz+mC9VY4 15600047 11350793 9951125 535 E: .043E0 Ident: 21/49 Ident% 42 Q: 944-992 (2346)   S: 12-58 (535) phosphoribosylaminoimidazolecarboxamide formyltransferase [Pseudomonas aeruginosa] phosphoribosylaminoimidazolecarboxamide formyltransferase PA4854 [imported] - Pseudomonas aeruginosa (strain PAO1) phosphoribosylaminoimidazolecarboxamide formyltransferase [Pseudomonas aeruginosa] Pos: 29/49 Gap: 2/49 e+TbSefzEuoNTGZb1rI5ydTiJv8 854566 2040 E: 0E0 Ident: 449/1086 Ident% 41 Q: 3-1072 (2346)   S: 260-1331 (2040) carbamyl phosphate synthetase [Saccharomyces cerevisiae] Pos: 644/1086 Gap: 30/1086 EqolC5JoCwbPqtQusz/v2vdU8sA 15899995 14971514 515 E: .017E0 Ident: 26/101 Ident% 25 Q: 941-1041 (2346)   S: 1-95 (515) phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Streptococcus pneumoniae TIGR4] phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Streptococcus pneumoniae TIGR4] phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Streptococcus pneumoniae TIGR4] phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase [Streptococcus pneumoniae TIGR4] Pos: 42/101 Gap: 6/101 9c9NI8jPeAGwBf3Ba5ju4/9B6+k 15837709 11272700 9106062 1080 E: 0E0 Ident: 738/1080 Ident% 68 Q: 1-1073 (2346)   S: 1-1079 (1080) carbamoyl-phosphate synthase large chain [Xylella fastidiosa 9a5c] carbamoyl-phosphate synthase large chain XF1107 [imported] - Xylella fastidiosa (strain 9a5c) carbamoyl-phosphate synthase large chain [Xylella fastidiosa 9a5c] Pos: 874/1080 Gap: 8/1080 E/DanI1pEZMd5fkGGnOKbQi7oOY 13591918 2541906 592 E: 1.3E0 Ident: 14/43 Ident% 32 Q: 952-994 (2346)   S: 12-54 (592) 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase [Rattus norvegicus] 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase [Rattus norvegicus] 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase [Rattus norvegicus] 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase [Rattus norvegicus] Pos: 23/43 Gap: -1/-1 92ZZOUSHAeKE2GgGki9tYUcnY84 15896649 15026495 630 E: .86E0 Ident: 17/101 Ident% 16 Q: 1-91 (2346)   S: 359-459 (630) NADH oxidase (two distinct flavin oxidoreductase domains) [Clostridium acetobutylicum] NADH oxidase (two distinct flavin oxidoreductase domains) [Clostridium acetobutylicum] NADH oxidase (two distinct flavin oxidoreductase domains) [Clostridium acetobutylicum] NADH oxidase (two distinct flavin oxidoreductase domains) [Clostridium acetobutylicum] Pos: 39/101 Gap: 10/101 W1TptnZ36KFO1eVbqKwqAywWEk0 16078672 3183562 7437894 2462967 2633981 385 E: .009E0 Ident: 28/205 Ident% 13 Q: 679-841 (2346)   S: 9-213 (385) succinyl-CoA synthetase (beta subunit) [Bacillus subtilis] Succinyl-CoA synthetase beta chain (SCS-alpha) (Vegetative protein 63) (VEG63) succinate--CoA ligase (ADP-forming) (EC 6.2.1.5) beta chain - Bacillus subtilis putative succinyl-coA synthetase beta chain [Bacillus subtilis] succinyl-CoA synthetase (beta subunit) [Bacillus subtilis] succinyl-CoA synthetase (beta subunit) [Bacillus subtilis] Succinyl-CoA synthetase beta chain (SCS-alpha) (Vegetative protein 63) (VEG63) succinate--CoA ligase (ADP-forming) (EC 6.2.1.5) beta chain - Bacillus subtilis putative succinyl-coA synthetase beta chain [Bacillus subtilis] succinyl-CoA synthetase (beta subunit) [Bacillus subtilis] Pos: 59/205 Gap: 42/205 TGHGKrdawUwzZXNa+Ho3ZSqIfkM 3850837 711 E: 8.1E0 Ident: 23/130 Ident% 17 Q: 586-715 (2346)   S: 417-530 (711) pimeloyl-CoA synthetase [Pseudomonas mendocina] pimeloyl-CoA synthetase [Pseudomonas mendocina] Pos: 42/130 Gap: 16/130 AZxGe0VXoJNc+L/WGgz02U2DLeE 16078189 543931 2118368 408119 2633461 2633478 1027 E: 0E0 Ident: 458/1056 Ident% 43 Q: 1-1053 (2346)   S: 1-1004 (1027) carbamoyl-phosphate transferase-arginine (subunit B) [Bacillus subtilis] Carbamoyl-phosphate synthase, arginine-specific, large chain (Carbamoyl-phosphate synthetase ammonia chain) Carbamoyl-phosphate synthase, arginine-specific, large chain (Carbamoyl-phosphate synthetase ammonia chain) carbamoyl-phosphate synthase (glutamine-hydrolyzing) (EC 6.3.5.5), arginine-repressible, large chain (carB) - Bacillus subtilis carbamoylphosphate synthetase subunit B [Bacillus subtilis] carbamoyl-phosphate transferase-arginine (subunit B) [Bacillus subtilis] carbamoyl-phosphate transferase-arginine (subunit B) [Bacillus subtilis] Pos: 637/1056 Gap: 55/1056 5eOTMErc4Nh/TtwVH1o3QnrJNZU 15794099 11272057 7379846 388 E: .037E0 Ident: 10/66 Ident% 15 Q: 676-736 (2346)   S: 6-71 (388) putative succinyl-CoA synthetase beta subunit [Neisseria meningitidis Z2491] probable succinate--CoA ligase (ADP-forming) (EC 6.2.1.5) beta chain NMA1153 [imported] - Neisseria meningitidis (group A strain Z2491) putative succinyl-CoA synthetase beta subunit [Neisseria meningitidis Z2491] putative succinyl-CoA synthetase beta subunit [Neisseria meningitidis Z2491] probable succinate--CoA ligase (ADP-forming) (EC 6.2.1.5) beta chain NMA1153 [imported] - Neisseria meningitidis (group A strain Z2491) putative succinyl-CoA synthetase beta subunit [Neisseria meningitidis Z2491] Pos: 21/66 Gap: 5/66 FAj+D+MWfhWx9YARQWEteU+bNew 16331605 7438086 1001668 1105 E: 0E0 Ident: 634/1081 Ident% 58 Q: 1-1068 (2346)   S: 25-1103 (1105) carbamoyl-phosphate synthase, pyrimidine-specific, large chain [Synechocystis sp. PCC 6803] carbamoyl-phosphate synthase (glutamine-hydrolyzing) (EC 6.3.5.5) large chain [similarity] - Synechocystis sp. (strain PCC 6803) carbamoyl-phosphate synthase, pyrimidine-specific, large chain [Synechocystis sp. PCC 6803] Pos: 795/1081 Gap: 15/1081 MlXXOENfp47HljXUoE9LRA+xhDY 15806266 7473940 6458989 386 E: .023E0 Ident: 15/105 Ident% 14 Q: 679-774 (2346)   S: 9-112 (386) succinyl-CoA synthetase, beta subunit [Deinococcus radiodurans] succinyl-CoA synthetase, beta subunit - Deinococcus radiodurans (strain R1) succinyl-CoA synthetase, beta subunit [Deinococcus radiodurans] succinyl-CoA synthetase, beta subunit [Deinococcus radiodurans] succinyl-CoA synthetase, beta subunit - Deinococcus radiodurans (strain R1) succinyl-CoA synthetase, beta subunit [Deinococcus radiodurans] Pos: 32/105 Gap: 10/105 4n7sSnM837KWLpk+61oo6O7kGeo 8393186 117492 68265 203576 1500 E: 0E0 Ident: 438/1082 Ident% 40 Q: 4-1071 (2346)   S: 419-1494 (1500) carboamyl-phosphate synthetase 1 [Rattus norvegicus] CARBAMOYL-PHOSPHATE SYNTHASE [AMMONIA], MITOCHONDRIAL PRECURSOR (CARBAMOYL-PHOSPHATE SYNTHETASE I) (CPSASE I) CARBAMOYL-PHOSPHATE SYNTHASE [AMMONIA], MITOCHONDRIAL PRECURSOR (CARBAMOYL-PHOSPHATE SYNTHETASE I) (CPSASE I) carbamoyl-phosphate synthase (ammonia) (EC 6.3.4.16) I precursor - rat carbamyl phosphate synthetase [Rattus norvegicus] Pos: 668/1082 Gap: 20/1082 jIUNeUXwNmSN+ES/rN/jZ7t8hzk 15642085 11272038 9656633 388 E: .004E0 Ident: 18/118 Ident% 15 Q: 132-233 (2346)   S: 8-125 (388) succinyl-CoA synthase, beta subunit [Vibrio cholerae] succinyl-CoA synthase, beta chain VC2085 [imported] - Vibrio cholerae (group O1 strain N16961) succinyl-CoA synthase, beta subunit [Vibrio cholerae] Pos: 38/118 Gap: 16/118 nE079fTf3c8kAYIZ7WsMIztEAuE 15679054 6647835 7437897 2622139 365 E: .015E0 Ident: 27/153 Ident% 17 Q: 676-816 (2346)   S: 6-158 (365) succinyl-CoA synthetase, beta subunit [Methanothermobacter thermautotrophicus] Succinyl-CoA synthetase beta chain (SCS-beta) succinyl-CoA synthetase, beta subunit - Methanobacterium thermoautotrophicum (strain Delta H) succinyl-CoA synthetase, beta subunit [Methanothermobacter thermautotrophicus] succinyl-CoA synthetase, beta subunit [Methanothermobacter thermautotrophicus] Succinyl-CoA synthetase beta chain (SCS-beta) succinyl-CoA synthetase, beta subunit - Methanobacterium thermoautotrophicum (strain Delta H) succinyl-CoA synthetase, beta subunit [Methanothermobacter thermautotrophicus] Pos: 50/153 Gap: 12/153 9ePy831yzlOquZ9O0yvfkB6QOX8 15614244 10174298 138 E: 6.1E0 Ident: 20/119 Ident% 16 Q: 944-1055 (2346)   S: 2-120 (138) methylglyoxal synthase [Bacillus halodurans] methylglyoxal synthase [Bacillus halodurans] Pos: 33/119 Gap: 7/119 LTK4tncyuTy5ugXquJ9+1GoNKDo 15897554 2500032 11268558 1304392 6015831 13813809 1051 E: 0E0 Ident: 404/1072 Ident% 37 Q: 4-1072 (2346)   S: 2-1051 (1051) Carbamoyl-phosphate synthase large subunit (carB) [Sulfolobus solfataricus] Carbamoyl-phosphate synthase large chain (Carbamoyl-phosphate synthetase ammonia chain) Carbamoyl-phosphate synthase large chain (Carbamoyl-phosphate synthetase ammonia chain) carbamoyl-phosphate synthase (glutamine-hydrolyzing) (EC 6.3.5.5), large chain - Sulfolobus solfataricus carbamoylphosphate synthetase, large subunit [Sulfolobus solfataricus] carbamoylphosphate synthetase, large subunit [Sulfolobus solfataricus] Carbamoyl-phosphate synthase large subunit (carB) [Sulfolobus solfataricus] Pos: 626/1072 Gap: 25/1072 9uz22hRFi6aSZMcCBZFcp3crolo 15791894 11272058 6968001 387 E: .24E0 Ident: 21/116 Ident% 18 Q: 132-231 (2346)   S: 8-123 (387) succinyl-coA synthetase beta chain [Campylobacter jejuni] succinate--CoA ligase (ADP-forming) (EC 6.2.1.5) beta chain Cj0533 [imported] - Campylobacter jejuni (strain NCTC 11168) succinyl-coA synthetase beta chain [Campylobacter jejuni] Pos: 47/116 Gap: 16/116 OHuYNqbPmzUD9CT9zLsu3DJdSaU 5921957 2118284 467223 1496 E: 0E0 Ident: 420/1076 Ident% 39 Q: 3-1065 (2346)   S: 415-1484 (1496) CARBAMOYL-PHOSPHATE SYNTHASE [AMMONIA], MITOCHONDRIAL PRECURSOR (CARBAMOYL-PHOSPHATE SYNTHETASE I) (CPSASE I) CARBAMOYL-PHOSPHATE SYNTHASE [AMMONIA], MITOCHONDRIAL PRECURSOR (CARBAMOYL-PHOSPHATE SYNTHETASE I) (CPSASE I) carbamyl phosphate synthetase - bullfrog carbamyl phosphate synthetase [Rana catesbeiana] Pos: 652/1076 Gap: 19/1076 Xe3388w/LOBYgag9P8Gp3IGo9wU 2117697 1311462 2317692 14250818 1588260 592 E: .095E0 Ident: 16/43 Ident% 37 Q: 952-994 (2346)   S: 12-54 (592) 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase [Homo sapiens] 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase [Homo sapiens] Pos: 24/43 Gap: -1/-1 XqfG6UehTRV5SHZG+2P6xm2Wj/E 17231301 17132943 1104 E: 0E0 Ident: 636/1103 Ident% 57 Q: 1-1068 (2346)   S: 1-1100 (1104) carbamoyl phosphate synthetase large chain [Nostoc sp. PCC 7120] carbamoyl phosphate synthetase large chain [Nostoc sp. PCC 7120] Pos: 801/1103 Gap: 38/1103 KLDC66B3GG3U2PFvj/ON1uJqj28 16803875 16411289 1070 E: 0E0 Ident: 531/1061 Ident% 50 Q: 1-1058 (2346)   S: 1-1052 (1070) highly similar to carbamoyl-phosphate synthetase (catalytic subunit) [Listeria monocytogenes EGD-e] highly similar to carbamoyl-phosphate synthetase (catalytic subunit) [Listeria monocytogenes] Pos: 725/1061 Gap: 12/1061 FmGubJjIPcirKaVLJOBp1V09+w8 15793592 11272704 7379337 1071 E: 0E0 Ident: 743/1074 Ident% 69 Q: 1-1073 (2346)   S: 1-1068 (1071) carbamoyl phosphate synthase large subunit [Neisseria meningitidis Z2491] carbamoyl-phosphate synthase (glutamine-hydrolyzing) (EC 6.3.5.5) large chain NMA0602 [imported] - Neisseria meningitidis (group A strain Z2491) carbamoyl phosphate synthase large subunit [Neisseria meningitidis Z2491] Pos: 873/1074 Gap: 7/1074 2X3IrpmztafucD8nXSU+6SGe5LI 15615033 10175090 386 E: .004E0 Ident: 15/70 Ident% 21 Q: 679-743 (2346)   S: 9-78 (386) succinyl-CoA synthetase (beta subunit) [Bacillus halodurans] succinyl-CoA synthetase (beta subunit) [Bacillus halodurans] succinyl-CoA synthetase (beta subunit) [Bacillus halodurans] succinyl-CoA synthetase (beta subunit) [Bacillus halodurans] Pos: 32/70 Gap: 5/70 uQpTqHDt2GDx1SpEb5AitsBcKh0 400909 2185 E: 0E0 Ident: 416/1067 Ident% 38 Q: 7-1058 (2346)   S: 365-1413 (2185) Protein PYR1-3 [Includes: Glutamine-dependent carbamoyl-phosphate synthase ; Aspartate carbamoyltransferase ; Dihydroorotase ] Protein PYR1-3 [Includes: Glutamine-dependent carbamoyl-phosphate synthase ; Aspartate carbamoyltransferase ; Dihydroorotase ] Pos: 620/1067 Gap: 33/1067 uPRqfGo1TPBC3PcxAfNLUuNKTz0 7481790 3288606 383 E: .27E0 Ident: 11/47 Ident% 23 Q: 678-724 (2346)   S: 8-54 (383) succinyl-Coa synthetase beta chain - Streptomyces coelicolor succinyl-coa synthetase beta chain [Streptomyces coelicolor A3(2)] succinyl-Coa synthetase beta chain - Streptomyces coelicolor succinyl-coa synthetase beta chain [Streptomyces coelicolor A3(2)] Pos: 18/47 Gap: -1/-1 9U+BEHPd1osSESWqdSeDWUZkI6I 15616660 11133949 10038723 525 E: .86E0 Ident: 17/48 Ident% 35 Q: 944-991 (2346)   S: 9-54 (525) phosphoribosylaminoimidazolecarboxamide formyltransferase / IMP cyclohydrolase [Buchnera sp. APS] phosphoribosylaminoimidazolecarboxamide formyltransferase / IMP cyclohydrolase [Buchnera sp. APS] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] Bifunctional purine biosynthesis protein purH [Includes: Phosphoribosylaminoimidazolecarboxamide formyltransferase (AICAR transformylase); IMP cyclohydrolase (Inosinicase) (IMP synthetase) (ATIC)] phosphoribosylaminoimidazolecarboxamide formyltransferase / IMP cyclohydrolase [Buchnera sp. APS] phosphoribosylaminoimidazolecarboxamide formyltransferase / IMP cyclohydrolase [Buchnera sp. APS] Pos: 27/48 Gap: 2/48 StXKt9rKK0k1mw9MGNR+Snhn9wg 7489180 1841460 138 E: .001E0 Ident: 16/32 Ident% 50 Q: 556-587 (2346)   S: 100-131 (138) probable carbamoyl-phosphate synthase (glutamine-hydrolyzing) (EC 6.3.5.5) large chain - common tobacco (fragment) putative carbamoyl phosphate synthetase, large chain [Nicotiana tabacum] probable carbamoyl-phosphate synthase (glutamine-hydrolyzing) (EC 6.3.5.5) large chain - common tobacco (fragment) putative carbamoyl phosphate synthetase, large chain [Nicotiana tabacum] Pos: 19/32 Gap: -1/-1 aSanyIP9fgwG02o0CKgVe2ue2OQ 1208504 148 E: 2.4E0 Ident: 17/129 Ident% 13 Q: 542-642 (2346)   S: 19-147 (148) acetyl CoA carboxylase [Schizosaccharomyces pombe] acetyl CoA carboxylase [Schizosaccharomyces pombe] Pos: 36/129 Gap: 28/129 dKLYmG73aZiaIGA5aN/JA3zCE8o 11272711 2661433 1064 E: 0E0 Ident: 546/1060